Overview

Comprehensive Description

Biology

Adults usually found on deep reefs (Ref. 2850). Viviparous, with planktonic larvae and pelagic juveniles (Ref. 36715). Occasionally captured by sport fishers (Ref. 2850).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Eastern Pacific: San Francisco in California, USA to southern Baja California, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13 - 14; Dorsal soft rays (total): 12 - 14; Analspines: 3; Analsoft rays: 5 - 7; Vertebrae: 25 - 26
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 460 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

46.0 cm TL (male/unsexed; (Ref. 2850)); max. published weight: 1,040 g (Ref. 40637); max. reported age: 32 years (Ref. 39277)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Branchiostegal rays: 7 (Ref. 36715).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paralectotype; Syntype for Sebastichthys constellatus Jordan & Gilbert
Catalog Number: USNM 24147
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan
Year Collected: 1880
Locality: San Francisco Cal., San Francisco County, California, United States, Pacific
  • Paralectotype: Jordan, D. S. & Evermann, B. W. 1898. Bulletin of the United States National Museum. No. 47: 1806.; Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 295.; Syntype: Jordan, D. S. & Evermann, B. W. 1898. Bulletin of the United States National Museum. No. 47: 1806.; Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 295.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paralectotype; Syntype for Sebastichthys constellatus Jordan & Gilbert
Catalog Number: USNM 27086
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: San Francisco, Cal., San Francisco County, California, United States, Pacific
  • Paralectotype: Jordan, D. S. & Evermann, B. W. 1898. Bulletin of the United States National Museum. No. 47: 1806.; Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 295.; Syntype: Jordan, D. S. & Evermann, B. W. 1898. Bulletin of the United States National Museum. No. 47: 1806.; Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 295.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lectotype; Syntype for Sebastichthys constellatus Jordan & Gilbert
Catalog Number: USNM 26963
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: Santa Barbara Channel, California, United States, Pacific
  • Lectotype: Jordan, D. S. & Evermann, B. W. 1898. Bulletin of the United States National Museum. No. 47: 1806.; Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 295.; Syntype: Jordan, D. S. & Evermann, B. W. 1898. Bulletin of the United States National Museum. No. 47: 1806.; Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 295.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paralectotype; Syntype for Sebastichthys constellatus Jordan & Gilbert
Catalog Number: USNM 153881
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1880
Locality: Monterey, Cal., Monterey County, California, United States, North America, Pacific
  • Paralectotype: Jordan, D. S. & Evermann, B. W. 1898. Bulletin of the United States National Museum. No. 47: 1806.; Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 295.; Syntype: Jordan, D. S. & Evermann, B. W. 1898. Bulletin of the United States National Museum. No. 47: 1806.; Jordan, D. S. & Gilbert, C. H. 1880. Proceedings of the United States National Museum. 3 (150): 295.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 5 - 5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 24 - 274 m (Ref. 2850), usually 60 - 149 m (Ref. 52190)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 5 - 5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 24 - 274m.
From 24 to 274 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Lymphocystis Disease. Viral diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Viviparous (Ref. 36715, 34817).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 32 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sebastes constellatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 20 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTTCTCCACTAATCACAAAGACATCGGCACCCTTTATCTAGTATTTGGTGCCTGAGCCGGTATAGTAGGCACAGCCCTCAGCCTACTCATTCGAGCAGAACTAAGCCAACCGGGCGCTCTCCTTGGAGACGACCAGATTTATAATGTAATCGTTACAGCACATGCCTTCGTAATGATTTTCTTTATAGTAATGCCAATTATAATTGGAGGTTTTGGAAACTGGTTAATTCCCCTAATGATTGGAGCCCCAGATATAGCATTTCCTCGTATAAATAACATAAGTTTCTGACTTCTACCCCCTTCTTTCCTGCTATTACTTGCCTCTTCTGGAGTAGAAGCGGGTGCCGGAACCGGGTGAACGGTGTACCCGCCCTTAGCCGGTAACTTAGCCCACGCAGGAGCATCAGTCGACCTGACAATCTTTTCACTTCACCTAGCAGGCATTTCCTCAATCCTTGGGGCAATCAATTTTATTACCACAATTATTAATATGAAGCCCCCGGCCATCTCTCAATATCAGACACCCCTGTTTGTGTGAGCCGTCCTAATTACCGCTGTTCTTCTCCTTCTCTCCCTACCAGTTCTCGCTGCCGGCATCACAATGCTCCTTACCGACCGGAATCTTAATACCACCTTCTTTGACCCGGCCGGAGGAGGGGATCCAATCCTTTACCAGCACTTATTCTGATTTTTTGGACACCCGGAAGTATATATTCTCATTCTGCCTGGCTTTGGTATGATTTCACACATCGTCGCCTATTACTCTGGCAAAAAAGAACCATTTGGTTATATAGGCATGGTATGGGCAATAATGGCTATTGGTCTTCTAGGTTTTATTGTATGAGCCCATCACATATTCACAGTTGGCATGGACGTAGACACGCGTGCTTACTTCACATCTGCCACAATAATCATCGCAATTCCCACCGGTGTTAAAGTATTTAGCTGACTTGCAACCCTTCATGGGGGCTCTATTAAATGAGAGACACCCCTTTTATGGGCCCTTGGCTTTATTTTCCTATTTACAGTAGGGGGGCTTACAGGCATTGTTCTGGCCAATTCATCCCTAGATATTGTACTCCACGATACCTATTATGTCGTAGCCCACTTCCACTACGTACTATCTATG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sebastes constellatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 20
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at British Antarctic Survey
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Starry rockfish

The starry rockfish (Sebastes constellatus) is a type of rockfish (Sebastidae) that lives mainly off the coasts of California and Baja California. This fish are also commonly called spotted corsair, spotted rockfish, chinafish, and red rock cod.

Description[edit]

The body of the starry rockfish is elongate, robust, heavy forward tapering to the tail. The head is rather pointed in profile and the mouth is large with the lower jaw projecting only slightly beyond the upper jaw when the mouth is closed. The body is red orange and profusely covered with small white spots. There are four or five large whitish blotches along the back. It is a very distinctive fish that is not easily confused with any other rockfish.

Range[edit]

The starry rockfish occurs from Thetis Bank, Baja California, to San Francisco, California, and is found around rocky offshore reefs at depths of 80 to 900 feet.

Natural history[edit]

As with other kinds of rockfish, fertilization is internal and live young are born. The young are usually born during March through May.

Fishing information[edit]

Starry rockfish contribute to the recreational anglers offshore reef catch. The typical rockfish rig and baits are appropriate gear (see bocaccio).

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!