Overview

Distribution

Worldwide except Australia.
Creative Commons Attribution 3.0 (CC BY 3.0)

© You Li, Zhiliang Wang, Jianjun Guo, Jesús Romero Nápoles, Yingchao Ji, Chunyan Jiang, Runzhi Zhang

Source: ZooKeys

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Plant / resting place / within
pupa of Bruchus rufimanus may be found in seed of Lathyrus

Plant / resting place / within
pupa of Bruchus rufimanus may be found in seed of Vicia

Foodplant / internal feeder
larva of Bruchus rufimanus feeds within seed of Phaseolus

Foodplant / internal feeder
larva of Bruchus rufimanus feeds within seed of Pisum sativum

Foodplant / internal feeder
larva of Bruchus rufimanus feeds within seed of Lupinus angustifolius

Plant / resting place / within
pupa of Bruchus rufimanus may be found in seed of Lens culinaris

Foodplant / internal feeder
larva of Bruchus rufimanus feeds within seed of Cicer arietinum

Foodplant / feeds on
adult of Bruchus rufimanus feeds on pollen? of Magnoliopsida
Remarks: season: 5-6(-8)

Plant / hibernates / under
adult of Bruchus rufimanus overwinters under bark of Broadleaved trees and shrubs
Remarks: season: 9-4

Animal / parasitoid
larva of Chremylus rubiginosus is parasitoid of Bruchus rufimanus

Animal / parasitoid
larva of Dinarmus acutus is parasitoid of Bruchus rufimanus

In Great Britain and/or Ireland:
Animal / parasitoid / ectoparasitoid
larva of Dinarmus basalis is ectoparasitoid of Bruchus rufimanus

Animal / parasitoid
larva of Dinarmus magnus is parasitoid of Bruchus rufimanus

Animal / parasitoid
larva of Lariophagus distinguendus is parasitoid of Bruchus rufimanus

Animal / predator
Pyemotes ventricosus is predator of egg of Bruchus rufimanus

Animal / parasitoid
larva of Stenomalina micans is parasitoid of Bruchus rufimanus

Animal / parasitoid / endoparasitoid
larva of Triaspis gibberosus is endoparasitoid of larva of Bruchus rufimanus

Animal / parasitoid / endoparasitoid
larva of Triaspis luteipes is endoparasitoid of larva of Bruchus rufimanus

Animal / parasitoid / endoparasitoid
larva of Triaspis pallidipes is endoparasitoid of larva of Bruchus rufimanus

Animal / parasitoid / endoparasitoid
larva of Triaspis primus is endoparasitoid of larva of Bruchus rufimanus

Animal / parasitoid / endoparasitoid
larva of Triaspis similis is endoparasitoid of larva of Bruchus rufimanus

Animal / parasitoid / endoparasitoid
larva of Triaspis stictostiba is endoparasitoid of larva of Bruchus rufimanus

Animal / parasitoid / endoparasitoid
larva of Triaspis thoracicus is endoparasitoid of larva of Bruchus rufimanus

Animal / parasitoid / endoparasitoid
larva of Uscana semifumipennis is endoparasitoid of egg of Bruchus rufimanus

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bruchus rufimanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTAATCGGAAAT---GACCAAATTTATAATGTAATCGTAACAGCCCATGCATTTATTATAATTTTTTTTATAGTTATACCAGTTATAATTGGGGGTTTTGGTAATTGATTAGTACCCCTAATATTAGGAGCTCCCGATATAGCATTCCCTCGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCTCTTACTCTTCTTTTAATGAGAAGCCTAGTAGAAAGAGGGGCAGGAACTGGTTGAACAGTTTACCCCCCTTTAGCTAGTAATATTGCCCATGGAGGATCTTCGGTAGATTTAGCAATTTTTAGGCTTCATTTAGCTGGGATTTCTTCTATTCTAGGAGCAGTTAATTTTATTACAACNGTAATTAATATGCGGCCTANAGGAATAANAATAGACCGANTACCTCTATTTTCTTGAGCAGTAGTAATTACAGCTATTCTCCTCCTCCTTTCTCTACCTGTTTTAGCAGGAGCTATTACAATATTATTAACAGACCGAAATCTAAATACATCATTTTTTGATCCTGCAGGAGGAGGTGACCCTATTTTATATCAACATTTATTTTGATTTTTTGGACACCCTGAAGTCTATATTTTAATTTTACCAGGATTTGGAATAATTTCACATATTATTAGGCAAGAAAGAGGTAAAAAAGAAGCTTTTGGAACATTAGGAATAATTTATGCTATAATAGCCATTGGACTTTTAGGATTTGTTGTATGAGCACACCACATATTTACTGTAGGGATAGATGTTGATACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bruchus rufimanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!