Physical Description

Type Information

Lectotype for Luffaria sebae Duchassaing & Michelotti, 1864
Catalog Number: USNM 31015
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Slide
Locality: St. Thomas Island, Virgin Islands of the United States, Caribbean Sea, North Atlantic Ocean
  • Lectotype: Duchassaing & Michelotti. 1864. Natuurk. Verh. holland Maatsch. Wet. Haarlem. 2(21)(3): 59.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 19 specimens in 1 taxon.
Water temperature and chemistry ranges based on 14 samples.

Environmental ranges
  Depth range (m): 6 - 108
  Temperature range (°C): 23.464 - 26.923
  Nitrate (umol/L): 0.339 - 2.158
  Salinity (PPS): 36.886 - 37.286
  Oxygen (ml/l): 4.722 - 4.819
  Phosphate (umol/l): 0.107 - 0.182
  Silicate (umol/l): 1.486 - 2.083

Graphical representation

Depth range (m): 6 - 108

Temperature range (°C): 23.464 - 26.923

Nitrate (umol/L): 0.339 - 2.158

Salinity (PPS): 36.886 - 37.286

Oxygen (ml/l): 4.722 - 4.819

Phosphate (umol/l): 0.107 - 0.182

Silicate (umol/l): 1.486 - 2.083
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aplysina lacunosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACTCTTTATTTATTATTTGGGGTTTTTGCTGGTATGATAGGAACAGCATTTAGTATGTTAATTAGACTGGAGTTATCTGCACCAGGCTCAATGTTAGGAGAC---GATCATTTATATAATGTTATAGTAACGGCACATGCTTTTGTTATGATATTCTTTTTAGTAATGCCTGTTATGATAGGGGGTTTTGGTAATTGATTAGTTCCATTATATATTGGAGCACCAGATATGGCTTTCCCTCGGTTAAATAATATTAGTTTTTGATTATTACCCCCAGCACTAATTTTATTATTGGGGTCTGCTTTTATAGAACAAGGGGCCGGTACGGGTTGAACCGTCTATCCGCCATTATCAAGTATACAAACACATTCTGGGGGTTCGGTAGATATGGCAATATTTAGTCTTCATTTGGCCGGAATTTCCTCCATATTAAGCTCTATTAATTTTATAACTACAATTTTAAATATGAGGGCGCCAGGGATGACTATGGACAGATTACCTTTATTCGTTTGATCTATTTTATTAACAACAATATTATTAGTATTAGCATTGCCCGTTTTAGCTGGAGCAATTACTATGCTTTTAACCGATAGAAATTTTAACACAACATTTTTTGATCCAGCAGGCGGGGGGGACCCAATTTTATATCAACATTTATTTTGATTTTTTGGGCACCCAGAAGTATATATTTTAATTTTACCAGGATTTGGTATTGTCTCACAAATTGTACCCACATTTGCGGCTAAAAAACAAATATTTGGTTATTTGGGTATGGTTTATGCCATGGCATCCATTGGGATATTAGGGTTTATCGTATGGGCCCATCATATGTTTACAGTTGGAATGGATGTAGACACACGTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Aplysina lacunosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!