Overview

Distribution

Range Description

This species is found in Venezuela, Guyana, French Guiana, Surinam, Colombia, eastern Ecuador, eastern Peru, north and central Brazil, eastern Bolivia, and Trinidad and Tobago (Gardner, 2007). In Venezuela it extends through the north coast range to the Maracaibo basin. It is found at elevations below 1,300 m (Eisenberg and Redford, 1999; Emmons and Feer, 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This marsupial is strongly associated with moist habitats and tropical evergreen forest. It is found in rainforest, often in the dense, tangled forest understory or in weedy areas. It is also found in vegetation along rivers and in secondary forests. This species is especially common in swampy, disturbed areas such as those dominated by Heliconia species in areas of modified forest. It tolerates secondary gowth and disturbed areas, such as plantations, fields, orchards, and human settlements.

This mouse opossum is arboreal, nocturnal, and insectivorous, but it is versatile in its habitat exploitation and is frequently trapped on the ground, sometimes near human dwellings. Its diet consists of about two-thirds insects and other small animals,and one-third fruit. The female is tolerant of the male only during estrus; copulation may last several hours, and gestation takes thirteen days. The litter size averages 5.8. The female constructs a leaf nest by transporting nesting material with her prehensile tail. Young are weaned at about 12 g body weight (Eisenberg and Redford, 1999; Emmons and Feer, 1997).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 3.6 years (captivity) Observations: One captive specimen lived 3.6 years (Richard Weigl 2005), though maximum longevity could be underestimated.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Marmosa murina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 27 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCTTATACTTACTATTTGGTGCTTGAGCAGGGATAGTGGGCACTGCTTTAAGCTTACTAATTCGTGCTGAACTAGGTCAACCTGGAACACTAATTGGAGACGACCAAATTTATAATGTTATTGTTACTGCTCACGCTTTTGTCATAATTTTCTTTATAGTAATACCCATCATAATTGGAGGCTTTGGCAACTGACTCGTACCATTAATAATTGGTGCCCCTGATATAGCCTTTCCACGAATAAATAATATAAGTTTCTGACTTCTTCCTCCATCATTCTTATTACTTCTAGCATCCTCAACAATTGAAGCAGGGGCTGGAACCGGATGAACAGTTTATCCTCCACTAGCTGGTAACCTAGCTCATGCAGGAGCCTCAGTTGACTTAGCAATTTTTTCTCTTCACCTAGCCGGAATTTCTTCTATTCTAGGGGCTATTAATTTTATTACTACTATTATTAATATAAAACCACCAGCAATATCTCAATATCAAACTCCCTTATTTGTTTGATCTGTAATAATTACAGCAGTTCTACTTTTACTATCTTTACCAGTTCTTGCCGCAGGGATTACTATACTCTTAACAGACCGAAATTTAAACACTACATTTTTTGATCCTGCTGGTGGAGGTGACCCAATCTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Marmosa murina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 28
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Brito, D., Astua de Moraes, D., Lew, D., Soriano, P. & Emmons, L.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern in because of its wide distribution, presumed large population, tolerance of some degree of habitat modification, occurrence in a number of protected areas and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category.

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is widespread and often common (Emmons and Feer, 1997).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No major threats are known to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species occurs in a number of protected areas throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Linnaeus's mouse opossum

Linnaeus's mouse opossum (Marmosa murina), also known as the common or murine mouse opossum, is a South American marsupial of the family Didelphidae.[1]

Range and habitat[edit]

Its range includes Colombia, Venezuela, Trinidad and Tobago, Guyana, Suriname, French Guiana, Brazil, eastern Ecuador, eastern Peru, and eastern Bolivia.

This opossum is most commonly sighted near forest streams and human habitation. A nocturnal creature, it shelters during the day in a mesh of twigs on a tree branch, a tree hole, or an old bird's nest.

Behavior[edit]

It eats insects, spiders, lizards, bird's eggs, chicks, and fruits.

Linnaeus's mouse opossum has a gestation period of approximately 13 days, and gives birth to 5–10 young.

Description[edit]

It is pale beige to grey on its underparts with short, smooth fur. Its face appears to have a black mask on it, its eyes are prominent, and its ears are very upright. Its tail, which females use to carry leaves, is much longer than the rest of its body.

Linnaeus's mouse opossum has a body length of approximately 11–14.5 centimetres (4.3–5.7 in), with a tail of approximately 13.5–21 cm (5.3–8.3 in) long. It weighs about 250 grams (8.8 oz).

References[edit]

  1. ^ a b Gardner, A. L. (2005). "Order Didelphimorphia". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. p. 9. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ Brito, D., Astua de Moraes, D., Lew, D., Soriano, P. & Emmons, L. (2008). Marmosa murina. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 28 December 2008.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!