Overview

Comprehensive Description

Biology

A marine species that ascends rivers (Ref. 5723, 10294). In fresh water, usually occurs at the surface of clear, quiet water over sand or gravel. Some landlocked populations, many of which have been established in impoundments as forage for sport fishes, reproduce in fresh water (Ref. 5723). Feeds on zooplankton (Ref. 10294).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Mostly along Atlantic and Gulf coasts from Massachusetts to Veracruz, Mexico. Some inland populations in California, Oklahoma, and Missouri likely were introduced (Lee et al. 1980). Introduced in Pecos River drainage, New Mexico (Sublette et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Massachusetts to southern Florida in USA and around Gulf of Mexico to northeastern Mexico.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Caribbean
Menidia beryllina occurs in the Western Central Atlantic from North Carolina, south to Florida, and the northern Gulf of Mexico from Laguna Madre, Tamaualipas, Mexico, east to Florida (Chernoff 2002, Richards 2006, Kells and Carpenter 2011). Menidia beryllina occurs in shallower waters from the surface to 30 m (inferred from records on www.fishnet2.org).



[Global Distribution: Western Atlantic: Maine to Florida, and the northern Gulf of Mexico from Laguna Madre, Tamaualipas, Mexico, east to Florida (Chernoff 2002, Richards 2006, Kells and Carpenter 2011). Some inland populations in California, Oklahoma, and Missouri likely were introduced (Lee et al. 1980). Introduced in Pecos River drainage, New Mexico (Sublette et al.1990).]
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Massachusetts to southern Florida in USA and around Gulf of Mexico to northeastern Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Atlantic slope basins.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Massachusetts to southern Florida in USA and around Gulf of Mexico to northeastern Mexico.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Page, L.M. and B.M. Burr, 1991; Robins, C.R. and G.C. Ray, 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Analsoft rays: 16 - 19; Vertebrae: 38 - 42
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 13 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 150 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

15.0 cm TL (male/unsexed; (Ref. 5723)); max. reported age: 2 years (Ref. 72478)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 15.0 cm TL (male/unsexed).
  • Bigelow, H.B. and W.C. Schroeder, 1953; Page, L.M. and B.M. Burr, 1991; Robins, C.R. and G.C. Ray, 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Neotype for Chirostoma beryllinum Cope
Catalog Number: USNM 50012
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): W. Kendall
Year Collected: 1897
Locality: Potomac River, Jackson City, Virginia, Opposite Washington, D.C., Arlington County, Virginia, United States, North America
  • Neotype: Chernoff, B. 1985. Copeia. 1985 (3): 792, 1.; Cope, E. D. 1869. Transactions of the American Philosophical Society. 13 (pt 2): 400-407.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Coastal and freshwater habitats. Moderate to highly alkaline and euryhaline waters. Moves far up streams and rivers, especially in southern part of range. In fresh water, usually swims at surface of clear quiet water over sand and gravel bottom. Introduced in ponds, lakes, and reservoirs outside native range. See Weinstein (1986) for habitat suitability index model. Spawns over beds of aquatic vegetation or among emergent vegetation (Moyle 1976). Survival and growth of larvae was greater at salinity of 15 ppt than at 5 or 30 ppt (see Sublette et al. 1990). Some landlocked populations (e.g., where introduced in reservoirs) reproduce in fresh water (Page and Burr 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Caribbean
Menidia beryllina is pelagic and can tolerant varying salinities (Richards 2006, Kells and Carpenter 2011). Menidia beryllina inhabits shallower waters of freshwater inland waterways, estuaries, and coastal areas (Chernoff 2002). The maximum total length (TL) of Menidia beryllina was recorded as 15 cm (Page and Burr 1991), however, Robins and Ray (1986), Chernoff (2002), and Kells and Carpenter (2011) noted M. beryllina maximum total length (TL) to be 10 cm. Menidia beryllina form large schools and is omnivorous (Kells and Carpenter 2011). Survival and growth of larvae was greater at salinity of 15 ppt than at 5 or 30 ppt (Sublette et al. 1990).

Reproduction
Menidia beryllina spawn between March and October primarily in tidal freshwater or brackish water (Richards 2006). Middaugh and Hemmer (1992) noted that spawning periods vary according to latitude and water temperature. In Rhode Island, spawning occurs in June and July (Bengtson 1984), in New Jersey from May to July (Coorey et al. 1985), in North Carolina from March to September (Hildebrand 1922), in Tampa, Florida all months except January and August (Springer and Woodburn 1960), and in coastal Texas from February to August (Gunter 1945). Menidia beryllina spawns over beds of aquatic vegetation or among emergent vegetation (Moyle 1976). Menidia beryllina is oviparous with demersal eggs and planktonic larvae (Richards 2006). Some landlocked populations (e.g., where introduced in reservoirs) reproduce in fresh water (Page and Burr 1991).

Lake Texoma, Oklahoma, United States (Hubbs 1982)

Growth
Growth in M. beryllina is density-dependent (increased growth when density is low) (Hubbs 1982). Females exhibit a faster growth rate than males. Mortality rates for males increase during spawning season (Hubbs 1982).

Diet
In Lake Texoma (Oklahoma), Hubbs (1982) found M. beryllina diet consisted of copepods, cladocerans and chironomids and feeding occurred largely during daylight hours (Saunders 1959, Elston and Bachen 1976).

Reproduction
Fecundity is size-dependent of females, with smaller females producing less eggs than larger females. Clutch sizes ranged from 384 to 1699 eggs, with an average of 984 eggs laid (Mense 1967). Females generally spawn daily during the spawning season (Hubbs 1982). Once Lake Texoma exceeded 30°C, spawning ceased. Thus, spawning by M. beryllina appears to be temperature dependent in Lake Texoma (Hubbs 1982).

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

pelagic-neritic; freshwater; brackish; marine; depth range 0 - ? m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 42 specimens in 3 taxa.

Environmental ranges
  Depth range (m): 0.225 - 2

Graphical representation

Depth range (m): 0.225 - 2
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pelagic; freshwater; brackish; marine; depth range; at the surface. A marine species that ascends rivers. In fresh water, usually occurs at the surface of clear, quiet water over sand or gravel. Some landlocked populations reproduce in fresh water.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Page, L.M. and B.M. Burr, 1991; Robins, C.R. and G.C. Ray, 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Eats mainly copepods, mysids, isopods, amphipods, and insects, especially chironomids. In California, cladocerans dominate the daytime diet while amphipods and insects larvae dominate at night; feeding peaks occur just after daybreak & just before dusk.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Copepods, mysids, shrimps, small squids and marine worms.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Page, L.M. and B.M. Burr, 1991; Robins, C.R. and G.C. Ray, 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Schools may number in the tens of thousands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Feeding mainly crepuscular; also reported as mainly diurnal with some night feeding.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Spawning protracted; multiple peaks suggested. Most spawn and die their 2nd summer of life; eggs hatch in 4-30 days at 13-34 C. Female may produce eggs throughout breeding season. Adult life span about 16 months (few survive 2nd winter). In northwestern Florida, most reproduction occurred February-April; some young-of-year matured in July-September and spawned (Copeia 1992:53-61).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Oviparous. Spawns from March to September.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Page, L.M. and B.M. Burr, 1991; Robins, C.R. and G.C. Ray, 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Menidia beryllina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Menidia beryllina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTGGTATTTGGTGCTTGAGCAGGAATGGTCGGAACAGCCCTAAGTCTCCTTATCCGGGCCGAACTGAGCCAACCGGGCTCTCTTCTGGGAGACGACCAAATTTATAATGTAATCGTCACCGCACATGCCTTCGTAATAATCTTCTTTATAGTAATACCAATTATGATTGGGGGCTTTGGAAACTGACTAATTCCCCTAATGATCGGGGCCCCCGATATGGCTTTCCCCCGAATGAACAATATGAGCTTCTGACTCCTCCCCCCATCGTTCCTCCTTCTCCTTGCCTCTTCAGGCGTTGAAGCCGGGGCAGGAACTGGGTGAACTGTTTATCCCCCCCTGTCTGGGAACCTCGCCCACGCTGGAGCGTCCGTGGATCTAACCATCTTCTCTCTTCATCTAGCAGGTGTCTCATCCATCCTGGGGGCTATCAATTTTATTACTACCATTGTTAACATGAAACCTCCAGCAATCTCACAGTACCAGACCCCGTTATTCGTCTGAGCTGTGCTGATCACTGCTGTGCTTCTCCTCCTCTCCCTCCCTGTCCTTGCTGCTGGCATCACCATGCTACTCACAGACCGAAACCTAAACACCACATTCTTTGACCCTGCAGGAGGGGGAGACCCAATCCTCTACCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Caribbean
Menidia beryllina occurs in the Western Central Atlantic from North Carolina, south to Florida, and the northern Gulf of Mexico from Laguna Madre, Tamaualipas, Mexico, east to Florida. Menidia beryllina can tolerate varying salinities, which allows it to utilize numerous habitat types. Further research is needed on the use and trade information, threats, and conservation actions for Menidia beryllina. Therefore, Menidia beryllina is listed as



.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Caribbean
Menidia beryllina is represented by a large number of subpopulations and locations. Total adult population size is unknown but relatively large. 332,533 M. beryllina were deposited in museum collections between the years 1881-2011 (Accessed through the FishNet 2 Portal, www.fishnet2.org, 2012-11-20).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: Localized threats may exist, but on a range-wide scale no major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Caribbean
There are no known threats for Menidia beryllina.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

Caribbean

There are no known species specific conservation measures for Menidia beryllina, but its distribution overlaps several marine protected areas.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Could serve as useful biological control agent for mosquitoes in water with salinities of 0-25 ppt (Middaugh et al. 1985). In Oklahoma and Texas, serves as forage for various game fishes, such as young white and largemouth bass and young and adult longnose gar (see Sublette et al. 1990). Has been used in carcinogenesis testing (Metcalfe 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Inland silverside

The inland silverside, Menidia beryllina, is a neotropical silverside native to eastern North America, and introduced into California. It is a fish of estuaries and freshwater environments.

Inland silversides are quite elongate even for silverside, with lengths 6 to 7 times depth. They have large eyes, a considerably upturned mouth, and a head noticeably flattened on top. Of the two widely separated dorsal fins, the anterior fin is small and has 4-5 weak spines, while the posterior fin is larger, with one spine and 8 or 9 rays. The lengthy anal fin is somewhat sickle-shaped, has one spine and 16 to 18 rays. As befits the name, they are silvery on the sides; the back is somewhat yellowish, and the underside is a translucent greenish. These are small fish, with 15 cm recorded, but most adults 10 cm or less.

They primarily feed on zooplankton, moving in enormous schools capable of depleting populations of the small arthropods and crustaceans they favor. In turn, they are prey for a variety of fish and birds. The silversides congregate in the shallows, generally over sand or gravel bottoms with overhead cover if possible, but then move out to open water in search of additional food, which increases predation risk. They are often observed in a sort of daily migration pattern as a result.

The exact native range of the inland silverside is not known; they are widespread along the Atlantic coast from Maine to Florida, and along the Gulf of Mexico. In the Mississippi River they can be found in backwaters and reservoirs as far north as Missouri and Illinois, hundreds of miles inland.

They were introduced into Clear Lake and the Blue Lakes of California in 1967, in order to control the Clear Lake gnat Chaoborus asticopus and midges, and in lakes and reservoirs of Alameda County and Santa Clara County the following year. From there they spread into the San Francisco Bay and Central Valley, and have since become widespread in central California. In some areas, they are the most abundant fish of any species. Moyle suggests that this fish may have contributed to the demise of the Clear Lake splittail, although the effect of the silversides' introduction on California ecosystems not been much studied.

Inland Silversides are currently an EPA approved indicator species for acute marine aquatic toxicity testing and short-term chronic toxicity estimating of marine and estuarine organisms.[1]

Notes [edit]

References [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Only recently firmly distinguished from M. peninsulae.

The nominal freshwater species, M. audens, was synonymized with coastal M. beryllina by Chernoff et al. (1981). Recently chromosomal differences between the inland and coastal populations have been discovered, but the available evidence was not regarded as sufficient to justify resurrecting M. audens as a valid species (Korth and Fitzsimons 1987). Suttkus and Thompson (2002) discussed the rediscovery of M. audens in the Pearl River (Mississippi and Louisiana) and provided evidence that M. audens is a valid species.

See Echelle et al. (1989) for information on the role of M. beryllina in the origin of unisexuals of the M. clarkhubbsi complex.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!