Overview

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The Butterfly Sculpin, M. papilio, is known from the Chukchi Sea in the Arctic, and the Kuril and Commander Islands. This species is not found in the Bering Sea, despite many reports of it being found there (D.E. Stevenson pers. comm. 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Arctic: Chukchi Sea. North Pacific: Hokkaido, Japan and Sea of Okhotsk and to Buldir Island in the Aleutian chain.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific and adjacent Arctic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11 - 13; Dorsal soft rays (total): 19 - 20; Analspines: 0; Analsoft rays: 16 - 18
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

30.0 cm SL (male/unsexed; (Ref. 559))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Scales on ventral scale row less than 1/2 the size of those on the dorsal scale row; fin membrane of spiny dorsal well incised; 4 preopercular spines; the 4th simple (Ref. 559).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Melletes papilio
Catalog Number: USNM 23751
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): H. Elliott
Year Collected: 1872
Locality: St. Paul's Island, Alaska, St. Paul Island, Alaska, United States, Pribilof Islands, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The Butterfly Sculpin is a benthic species that has a depth range of 4-320 m and inhabits Arctic to subarctic waters at less than 1°C. Sculpins can be found over all substrate types: rock, sand and mud.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 4 - 320 m (Ref. 50550)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 56 specimens in 1 taxon.
Water temperature and chemistry ranges based on 47 samples.

Environmental ranges
  Depth range (m): 3 - 104
  Temperature range (°C): -1.581 - 1.824
  Nitrate (umol/L): 1.348 - 27.720
  Salinity (PPS): 31.604 - 33.163
  Oxygen (ml/l): 6.143 - 8.585
  Phosphate (umol/l): 0.727 - 2.356
  Silicate (umol/l): 15.204 - 62.630

Graphical representation

Depth range (m): 3 - 104

Temperature range (°C): -1.581 - 1.824

Nitrate (umol/L): 1.348 - 27.720

Salinity (PPS): 31.604 - 33.163

Oxygen (ml/l): 6.143 - 8.585

Phosphate (umol/l): 0.727 - 2.356

Silicate (umol/l): 15.204 - 62.630
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hemilepidotus papilio

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCTTGAGCCGGAATAGTGGGCACAGCCCTAAGCCTCCTAATTCGAGCAGAGCTGAGCCAACCCGGAGCCCTTTTAGGGGACGACCAAATTTATAATGTAATTGTTACGGCCCATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATCATGATCGGAGGCTTTGGAAACTGACTCATCCCTCTGATGATCGGCGCCCCCGACATAGCATTTCCTCGAATAAATAACATGAGCTTCTGGCTTCTTCCTCCCTCCTTTCTACTGCTCCTCGCCTCATCAGGGGTAGAAGCAGGGGCCGGAACGGGGTGAACAGTTTATCCCCCTCTCGCTGGCAATCTGGCTCACGCGGGAGCCTCTGTTGACCTGACAATTTTCTCCCTCCATCTGGCAGGGATCTCCTCAATTCTTGGAGCAATTAATTTTATCACAACCATCATCAACATGAAACCCCCTGCCATCTCTCAGTACCAGACGCCTCTTTTCGTGTGATCCGTTCTTATCACGGCCGTCTTACTCCTTCTCTCCCTGCCAGTCCTTGCTGCCGGCATCACAATGCTTCTAACAGACCGCAATCTTAACACCACCTTCTTCGACCCCGCGGGTGGTGGAGACCCCATTCTCTACCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hemilepidotus papilio

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Stevenson, D.

Reviewer/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P. & Smith, J. and Livingston, F.

Justification
The Butterfly Sculpin, Melletes papilio, has been assessed as Least Concern. Despite the threat of being taken as by-catch by commercial fisheries there is no known evidence of this species undergoing significant population declines. Monitoring of the population numbers and harvest levels of this species is needed to ensure incidental harvest does not pose a major threat to the population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no population information available for M. papilio.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Sculpins are caught incidentally by a wide variety of fisheries and it is likely that the larger sculpin species, including species from the genus Hemilepidotus, are commonly taken by groundfish fisheries (Reuter et al. 2006). Melletes papilio occurs in some major fishing areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for M. papilio, however its distribution may cover a number of marine protected areas including the Wrangel Island Strictly Protected Nature Reserve in the Chukchi Sea.

Monitoring of the harvest levels and population numbers of this species is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!