Overview

Brief Summary

The California grunion (Leuresthes tenuis) is a small New World silverside fish (family Atherinopsidae) found only on the Southern California coast from Point Conception as far south as Punta Abreojos (about half-way down the Baja peninsula) although the majority of the population is thought to live in Los Angeles county, Orange County and San Diego county. The California grunion is well-known for its unique springtime spawning behavior that it accomplishes not in the water, but at extreme high tides on sandy beaches on nights just after the full moon and the new moon. During these times, the females ride waves up as far up the beach as they can, dig their tails into the sand, and wait for subsequent waves to bring males to them. Males (sometime multiple) wind their bodies around the female and spawn, releasing sperm that flow down the female’s body to fertilize the eggs she lays in the sand, about four inches under the surface. When the process is done, males and females return to the sea. The buried eggs incubate in the moist sand and usually hatch when agitated by the surf in the next high tide series. Grunion mature after one year, and live about three years, inhabiting local coastal waters up to 60 feet deep. Females spawn as many as six times each season, during which time they lay a total of about 18,000 eggs.

Although they seem abundant during spawning runs, scientists believe the population size of California grunion is quite restricted. Birds, fish and sea lions are among predators of grunion. However the biggest threat to grunion is human activity: pollution of waters, development of spawning grounds, beach grooming using tools that disrupt egg nests, and human harvesting, which disrupts spawning runs. Recreational fishing is allowed, by license, but only when grunion are caught by hand, without nets or other tools. The season is closed during peak spawning time, April-June, when grunion are most vulnerable.

The genus (Leuresthes) contains only one other species, the Baja grunion (L. sardinas), which lives only in the gulf of California where it carries out similar spawning behavior.

(California Department of Fish and Game 2012; grunion.org; Wikipedia 2011)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Adults inhabit inshore waters, usually at or near surface along open coast and in bays (Ref. 36497). Oviparous, with planktonic primarily neustonic larvae (Ref. 36497). Eggs are deposited in the sand at night by the female parent (Ref. 58332) just below the high spring tide line (Ref. 36497). Minimum depth reported taken from Ref. 57178.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific: Monterey Bay, USA to Baja California Sur, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: San Francisco, California, to Magdalena Bay, Baja California, but rare north of Point Conception in southern California.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 4 - 8; Dorsal soft rays (total): 8 - 10; Analspines: 1; Analsoft rays: 20 - 24; Vertebrae: 47 - 50
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 190 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

19.0 cm TL (male/unsexed; (Ref. 2850)); max. reported age: 8 years (Ref. 1744)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Branchiostegal rays: 6 (Ref. 36497).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Leuresthes crameri
Catalog Number: USNM 47583
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: Ballenas B. L. Cal., California, United States, North America
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth: 0 - 18m.
Recorded at 18 meters.

Habitat: pelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

pelagic-neritic; marine; depth range 0 - 18 m (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 1 - 1.83

Graphical representation

Depth range (m): 1 - 1.83
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Demersal spawners. Spawn at night on sand beaches at high tides in the spring and summer. Eggs are buried in moist sand by the female parent (Ref. 58332) and hatch about 15 days later during the next series of high tides (Ref. 2850). Females spawn 4 to 8 times during a season (Ref. 4563).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 8 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Leuresthes tenuis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTCTACCTAGTATTTGGTGCTTGAGCTGGAATAGTGGGGACTGCTTTAAGCCTCCTAATCCGGGCTGAACTCAGCCAACCAGGCTCTCTCCTAGGAGACGACCAGATTTATAATGTTATCGTTACGGCACATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGAGGTTTCGGAAACTGACTAATCCCCCTTATGATCGGGGCCCCTGATATGGCTTTCCCTCGAATAAATAACATGAGCTTTTGACTTCTTCCCCCCTCATTTCTGCTTCTCCTGGCTTCTTCAGGGGTAGAAGCAGGTGCTGGCACCGGATGAACAGTTTATCCCCCTCTATCTGGGAATCTAGCCCACGCCGGAGCATCCGTTGACCTAACTATCTTCTCCCTTCACTTAGCAGGTGTGTCATCGATTCTAGGCGCCATTAATTTTATTACAACAATTATTAACATAAAACCCCCCGCAATTTCACAATACCAAACCCCTCTTTTCGTGTGGGCTGTCCTGATTACCGCCGTACTTCTCCTTTTATCCCTTCCTGTTCTTGCTGCCGGAATTACCATGCTTCTCACTGACCGGAATCTGAATACCACCTTCTTTGACCCCGCCGGGGGGGGAGACCCCATTCTTTACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Leuresthes tenuis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Leuresthes tenuis

Leuresthes tenuis, the California Grunion, is a species of grunion native to the Pacific coast of North America from Monterey Bay in California to Baja California. This species grows to a length of 19 centimetres (7.5 in) TL and is of minor importance to local fisheries, particularly during grunion runs in which the fish beach themselves to mate and lay eggs and are easily taken.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Patterns of allozyme variation indicate a population structure that approximates panmixia but also suggests isolation by distance (Gaida et al. 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!