Overview

Comprehensive Description

Biology

Nearly always found in shallow water, preferring habitats with dense vegetation in small lakes, ponds and slow moving rivers and streams. Feed on small aquatic invertebrates, insects, and occasionally small fishes. (Ref. 4543, 10294).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Longear sunfish are only found in North America, primarily in the Mississippi and Great Lakes watersheds. The species ranges from Minnesota east to Ontario, Ohio, and western Pennsylvania southward through the Mississippi Basin to the Gulf states of Mexico and east to the Apalachiocola River.

Biogeographic Regions: nearctic (Native )

  • Huck, L., G. Gunning. 1967. Behavior of the Longear Sunfish, *Lepomis megalotis* (Rafinesque). Tulane Studies in Zoology, 14(3): 121-131.
  • Trautman, M. 1957. The Fishes of Ohio. Columbus: Ohio State University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America: northeastern Mexico and north to the Great Lakes.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The native territory of the longear sunfish, Lepomis megalotis, is exclusive to North America; it is found primarily in the Mississippi and Great Lakes watersheds. The species ranges from Minnesota east to Ontario, Ohio, and western Pennsylvania southward through the Mississippi Basin to the Gulf states of Mexico and east to the Apalachiocola River.

Biogeographic Regions: nearctic (Native )

  • Huck, L., G. Gunning. 1967. Behavior of the Longear Sunfish, *Lepomis megalotis* (Rafinesque). Tulane Studies in Zoology, 14(3): 121-131.
  • Trautman, M. 1957. The Fishes of Ohio. Columbus: Ohio State University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: This species is native to the St. Lawrence-Great Lakes, Hudson Bay, Mississippi River, and Gulf Slope drainages west of the Appalachians, from southern Quebec to western Ontario and Minnesota, and south to the Florida panhandle and southern Texas; Gulf Slope from Choctawhatchee River, Florida, to Rio Grande system, Texas, New Mexico, and northeastern Mexico (Page and Burr 1991). It has been introduced in some other places in the United States.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

East-central North America, introduced elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Members of the Centrarchidae are flattened, brightly colored, ‘pan-fish’. The most unique feature of longear sunfish is their elongated gill cover, or opercular flap, giving an appearance of a ‘long ear’. They are relatively small sunfish with individuals are usually 71 to 94 mm in length, although one 240 mm fish was found in Michigan. Females are generally slightly smaller than males. Mature males are generally brighter and have a more pronounced opercular flap than females, up to 230 mm long.

Longear sunfish are greenish to rusty brown on the back, with lighter colored sides and yellow to orange-red bellies. They have bright specks of blue, green, yellow, and orange along the back and sides. Their cheeks are orange with wavy blue streaks near their mouths and eyes. The opercular flap is black and bordered with light red to yellow. Males who are breeding become bright iridescent green on the back and bright orange on the belly, and the fins turn a deep rusty orange color.

Longear sunfish are easily confused with several closely related species, including: L. gibbosus, L. macrochirus, L. microlophus and L. humilis.

Range length: 240 (high) mm.

Average length: 71-94 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: male larger; male more colorful

Average mass: 434.5 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Members of the family Centrarchidae are strongly compressed, brightly colored, ‘pan-fish’. The most distinguishing characteristic of longear sunfish is their elongated opercular flap, giving an appearance of a ‘long ear’. They are relatively small sunfish with individuals rarely reaching a total length of more than 12 cm, although one 24 cm fish was found in Michigan. Females are generally slightly smaller than males. Mature males are generally brighter and have a more pronounced opercular flap than females, up to 230 mm long.

Becker (1983) describes longears as having: “2 dorsal fins, but broadly joined and appear as 1; base of dorsal fins about twice the length of anal fin base; first dorsal fin with 10 spines, second with 10-11 soft rays. Anal fin with 3 spines, and 9-11 soft rays; pelvic fin thoracic with 1 spine and 5 rays; pectoral fin short, bluntly pointed to rounded, and when laid forward across cheek barely reaching posterior edge of eye; caudal fin slightly forked. Scales ctenoid, in lateral line 34-38; lateral line complete. Back olive to rusty brown; sides lighter; breast and belly yellow to orange-red. Back and sides with specks of yellow, orange, emerald, and blue; 8-10 vertical bars conspicuous to absent. Cheeks orange with wavy blue streaks radiating back from the mouth and eye. Ear flap black, narrowly edged with pale red to yellow (white in immature and all preserved specimens). Dorsal and anal fins olive, often with rusty orange wash; in preserved specimens, soft dorsal fin with parallel rows of light dots. Pectoral fins clear to lightly pigmented. Breeding male iridescent green above and bright orange below; the vertical fins a deep rusty orange; and pelvic fins blue-black. Scale pockets with dark pigmented crescents pointing anteriorly. Breeding females less brilliantly colored.”

Longear sunfish are most easily confused with several of the other sunfish of the genus Lepomis including: the pumpkinseed, L. gibbosus; the bluegill, L. macrochirus, the redear sunfish, L. microlophus; and the orangespotted sunfish, L. humilis.

More Lepomis megalotis images can be found at:   http://www.nativefish.org/cgi-bin/cgiwrap/nativefish/gallery.pl?MODE=FISH_VIEW&ID=735 

Range length: 240 (high) mm.

Average length: 71-94 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: male larger; male more colorful

Average mass: 434.5 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 240 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

24.0 cm TL (male/unsexed; (Ref. 5723)); max. published weight: 790 g (Ref. 4699); max. reported age: 6 years (Ref. 12193)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 20 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Lepomis megalotis
Catalog Number: USNM 3560
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): Goode
Locality: Near Head of Simcum, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Longear sunfish, like other members of the Centrarchidae, are freshwater fishes. In the warmer months of spawning season longear sunfish are generally found in shallower, warmer waters near the sources of streams which have pools with a flowing current. They prefer streams with a hard bottom of clay or gravel with clear waters and they usually stay in or near aquatic plants. Although more abundant near the sources of streams, they can be found in streams and rivers of all sizes and are also found in lakes. Compared to other members of the Centrarchidae, longear sunfish are better at getting food in moving waters than still waters. This may explain why longear sunfish are more abundant in streams than lakes compared to other members of the family. They cannot tolerate cloudy water. Throughout the 20th century their populations have been reduced in areas where their native streams have suffered increased cloudiness.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

  • Becker, G. 1983. Fishes of Wisconsin. Madison: The University of Wisconsin Press.
  • Berra, T., G. Gunning. 1972. Season Movement and Home Range of the Longear Sunfish, *Lepomis megalotis* (Rafinesque) in Louisiana. The American Midland Naturalist, 88(2): 368-375.
  • Gerking, S. 1953. Evidence for the Concepts of Home Range and Territory in Stream Fishes. Ecology, 34(2): 347-365.
  • Page, L., B. Burr. 1991. The Peterson Field Guide Series: A Field Guide to Freshwater Fishes. Boston: Houghton Mifflin Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Longear sunfish, like other members of the sunfish family Centrarchidae, are freshwater fishes. In the warmer months of spawning season longear sunfish are generally found in shallower, warmer headwaters of streams which have numerous pools with permanent or semi-permanent flow. They prefer waters with a hard bottom of clay or gravel with clear waters and usually in or near aquatic vegetation. Although more abundant in headwaters, they can be found in streams and rivers of all sizes and are also found in lakes. Compared to other members of the sunfish family Centrarchidae, longear sunfish are better at obtaining food in moving waters than still waters. This may explain why longear sunfish are more abundant in streams than lakes compared to other members of the family, most of which are common within its geographic range. They are intolerant to turbid waters. Throughout the 20th century their populations have been reduced in areas where their native streams have suffered increased turbidity.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

  • Becker, G. 1983. Fishes of Wisconsin. Madison: The University of Wisconsin Press.
  • Berra, T., G. Gunning. 1972. Season Movement and Home Range of the Longear Sunfish, *Lepomis megalotis* (Rafinesque) in Louisiana. The American Midland Naturalist, 88(2): 368-375.
  • Gerking, S. 1953. Evidence for the Concepts of Home Range and Territory in Stream Fishes. Ecology, 34(2): 347-365.
  • Page, L., B. Burr. 1991. The Peterson Field Guide Series: A Field Guide to Freshwater Fishes. Boston: Houghton Mifflin Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 7 taxa.

Environmental ranges
  Depth range (m): 0.5 - 0.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Longear sunfishes prefer clear, shallow, well-vegetated areas of low-gradient streams (Sublette et al. 1990), but they do thrive in some reservoirs. Typically they are in headwaters, creeks, and small to medium rivers in uplands. Often they are seen in rocky and sandy pools, usually near vegetation. They avoid strong current, turbid water, and silt bottoms.

Eggs are laid in nests made by males in shallow water in gravel (or sometimes sand or hard mud), at depths ranging from about 8 inches (20 cm) to as much as 10 feet (300 cm) or more.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Longear sunfish feed nearer to the surface than other sunfish. They mostly eat aquatic insecta, small crustacea, actinopterygii eggs (including those of its own species), young micropterus, and young lepomis. They have been observed eating odonata and other insects, which touch the surface of the water. Other foods include detritus, Nematocera larvae, day diptera, gastropoda and Hirudinea.

Longear sunfish have also been seen following Hypentelium nigricans. As a northern hognose sucker moves along the bottom shoving pebbles around and picking them up with its mouth, longear sunfish will move along beside the sucker, picking around and feeding in the gravel after the sucker stirs it up.

Animal Foods: fish; eggs; insects; terrestrial non-insect arthropods; mollusks; aquatic or marine worms

Other Foods: detritus

  • Berra, T. 2001. Freshwater Fish Distribution. San Diego: Academic Press.
  • Forbes, S., R. Richardson. 1920. The Fishes of Illinois. Danville: Published by Authority of the State of Illinois.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nearly always found in shallow water, preferring habitats with dense vegetation in small lakes, ponds and slow moving rivers and streams. Feed on small aquatic invertebrates, insects, and occasionally small fishes (Ref. 4543).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Longear sunfish feed nearer to the surface than other sunfish. They mostly eat aquatic insects, microcrustaceans, fish eggs (including those of its own species), young bass, and young sunfish. They have been observed eating dragonflies and other insects, which touch the surface of the water.

Longear sunfish have also been observed follow northern hognose suckers, Hypentelium nigricans. As a northern hognose sucker moves along the bottom shoving pebbles around and picking them up with its mouth, longear sunfish will move along beside the sucker, picking around and feeding in the gravel after the sucker stirs it up.

Foods eaten include: aquatic insects – mostly midgeflies, microcrustaceans, fish eggs, terrestrial insects, young bass, newly hatched sunfish, including its own species, detritus, gnat larvae, day flies, snails and leeches.

Animal Foods: fish; eggs; insects; terrestrial non-insect arthropods; mollusks; aquatic or marine worms

Other Foods: detritus

Primary Diet: carnivore (Insectivore )

  • Berra, T. 2001. Freshwater Fish Distribution. San Diego: Academic Press.
  • Forbes, S., R. Richardson. 1920. The Fishes of Illinois. Danville: Published by Authority of the State of Illinois.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds throughout water column mainly on various invertebrates, fish eggs, and, in larger individuals, fishes (Manooch 1984, Becker 1983); also some filamentous algae.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Sunfish are an important link in the food chain. They act as both predator and prey.

  • Schaefer, J., W. Lutterschmidt, L. Hill. 1999. Physiological performance and stream microhabitat use by the centrarchids *Lepomis megalotis* and *Lepomis macrochirus*. Environmental Biology of Fishes, 54(3): 303-312.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

In nature, longear sunfish have been seen to hide in aquatic plants near hard structures (like stumps or woody debris) or in otherwise shaded areas to avoid predation. They also will dart into deeper waters when threatened. Predators of longear sunfish, like Micropterus salmoides and ardeidae hunt using their sight and the brightly colored longear sunfish probably benefits by hiding where it is less likely to be spotted. Adult longear sunfish have been shown to occupy deeper, and thus darker, waters in the mornings and evenings when large predators are most active. Spawning occurs in shallow waters. The shallowness of the waters may give longear sunfish nests and eggs some protection from larger aquatic predators.

Known Predators:

  • largemouth bass (Micropterus_salmoides)
  • wading birds (Ardeidae)
  • largemouth bass (Micropterus_dolomieu)

  • Witt Jr., A., R. Marzolf. 1954. Spawning and Behavior of the Longear Sunfish, *Lepomis megalotis megalotis*. Copeia, 1954(3): 188-190.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

In general, sunfish are an essential intermediate link in the food chain, providing a continuum between higher and lower trophic levels. They are both predators and prey.

  • Schaefer, J., W. Lutterschmidt, L. Hill. 1999. Physiological performance and stream microhabitat use by the centrarchids *Lepomis megalotis* and *Lepomis macrochirus*. Environmental Biology of Fishes, 54(3): 303-312.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

In nature, longear sunfish have been observed to hide in aquatic vegetation near hard structures (like stumps or woody debris) or in otherwise shaded areas to avoid predation. They also will dart into deeper waters when threatened. Predators of the longear sunfish, like the largemouth bass, Micropterus salmoides, and wading birds, are visual predators and the brightly colored longear sunfish probably benefits by hiding where it is less likely to be spotted. Adult longear sunfish have been shown to occupy deeper, and thus darker, waters in the mornings and evenings when large predators are most active. Spawning occurs in shallow waters. The shallowness of the waters may afford longear sunfish nests and eggs some protection from larger aquatic predators.

Goddard and Mathis’s (1997) laboratory studies showed that given a choice longear sunfish prefer to occupy low light intensity conditions without cover rather than submerged cover under higher light intensity conditions. The authors stated that areas with more vegetation may be harder to maneuver in and make escape from predators more difficult. In equally well lit conditions, the longear sunfish will choose the area with submerged cover, so it chooses some protection over none.

Known Predators:

  • Witt Jr., A., R. Marzolf. 1954. Spawning and Behavior of the Longear Sunfish, *Lepomis megalotis megalotis*. Copeia, 1954(3): 188-190.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Lepomis megalotis preys on:
non-insect arthropods
Actinopterygii
Mollusca
Arthropoda
Insecta

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Lepomis megalotis is prey of:
Ciconiiformes
Micropterus dolomieu

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Home range estimated at about 30-60 m of stream (Becker 1983)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Longear sunfish have a number of behavioral display postures that are probably used in communication such as when the male the turns on his side and displays his bright orange belly, when he turns toward another fish and lifts up his gill covers, biting, courtship circling, and so on. Male longear sunfish are also known to make a distinctive grunting sound during courtship and spawning.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; acoustic

  • Jenkins, R., N. Burkhead. 1993. Freshwater Fishes of Virginia. Bethesda: American Fisheries Society.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Longear sunfish exhibit a number of behavioral display postures that are probably used in communication such as when the male the turns on his side and displays his bright orange ventral surface, frontal display (orienting toward another fish and erection of the opercula and accompanied by sigmoid bending of the body), biting, courtship circling, and so on. Male longear sunfish are also known to make a distinctive grunting sound during courtship and spawning.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; acoustic

  • Jenkins, R., N. Burkhead. 1993. Freshwater Fishes of Virginia. Bethesda: American Fisheries Society.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

The number of young that successfully hatch may range from 52 to 1,132. In nature, the eggs hatch in 3 to 5 days, in an aquarium they can hatch in 2 days. Swimming up to the water surface and feeding can begin 7 days after hatching in an aquarium.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nests side by side arranged in dense colonies near shore. Male digs nest and defends territory during prespawning period. Female approaches nesting colony when nest completed. Mating pairs swim in circles over nest, stop for short intervals to release sperm and egg. Male may chase mate away from nest, female may come back to same nest or move on to mate with another (Ref 4543).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

The number of larvae that successfully hatch may range from 52 to 1,132. In nature, the eggs hatch in 3 to 5 days, in aquaria they can hatch in 2 days. Swimming up to the water surface and feeding can begin 7 days after hatching in aquaria.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Most longear sunfish do not live beyond four years, although one individual found in the wild in Michigan was nine years old.

Typical lifespan

Status: wild:
9 (high) years.

Average lifespan

Status: wild:
3-4 years.

Average lifespan

Status: captivity:
12.0 years.

  • Cooper, E. 1983. Fishes of Pennsylvania and the Northeastern United States. University Park: The Pennsylvania State Universty Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Most longear sunfish do not live beyond four years, although one individual found in the wild in Michigan was nine years old.

Typical lifespan

Status: wild:
9 (high) years.

Average lifespan

Status: wild:
3-4 years.

Average lifespan

Status: captivity:
12.0 years.

  • Cooper, E. 1983. Fishes of Pennsylvania and the Northeastern United States. University Park: The Pennsylvania State Universty Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Female longear sunfish prefer male longears with longer opercular flaps. When a breeding female enters a nesting colony, a male longear sunfish will attempt to lead her to its nest. Leading involves behavior where the male spreads its fins, swims directly toward the female and then returns directly to his nest. If a female follows the male to his nest, they begin a circular spiral of the nest with the female always toward the center. Several spawning events will occur and then the female is chased from the nest. In one study, the total number of eggs laid in a nest varied from about 137 to 2,836 eggs.

Immediately after the female leaves, the male begins to fan the nest with his fins. He then swims vertically over the nest and fans with his tail. The fanning is strong enough to move small pebbles. He will fan the nest up to an hour after the spawning event. This behavior may help mix the eggs and sperm and help drive the eggs deep into the gravel. The female, after being chased from the nest, will enter the nests of other males for additional spawning events.

Mating System: polyandrous

Longear sunfish nest in colonies, although in some populations individuals will build solitary nests. Colony size and the distance between the nests vary. In crowded conditions the colonies can be quite large with the nests so close together their rims almost touch. In dense conditions the male fish only defends the nest itself. In less dense conditions, the nests are further apart and the male will guard a territory slightly larger than the nest.

Male longear sunfish build the nest without aid from the female. In late spring or early summer, males move into relatively shallow water (20 to 60 cm deep) and establish territories in which they build nests. They prefer to nest in gravel if available; otherwise, they will build in sand or hard mud. The nest is created by the powerful sweeping of the male’s tail (called tail-wags) across the bottom while the fish swims at a 45° angle to the gravel. This action results in a circular depression that is about 35 to 45 cm in diameter, 3 to 7 cm deep, with rims 7 to 9 cm wide. Water temperatures in the nest area are relatively warm and vary from approximately from 23° to 31° C. They will reoccupy nests abandoned by other sunfish.

Male longear sunfish also have an interesting alternative reproductive strategy to nest building. Some males are sneakers. The sneaker male is generally younger and less colorful than a nest building (dominant) male. The sneaker male mimics the appearance of a female longear sunfish. The sneaker will hide near an active nest and dash into the nest and release sperm while the dominant male is spawning with a female. The satellite male is similar in age and appearance to the sneaker male, but instead of dashing into the nest, he will hover over a nest, acting like a non-threatening female, and slowly swim down into the nest containing a breeding pair of sunfish and, like the sneaker, release sperm during the spawning event. Male longear sunfish that build solitary nests have better success defending their nests from sneaker and satellite males than males with nests in colonies.

Breeding season: Late May to late August

Range number of offspring: 137 to 2800.

Range time to hatching: 2 to 7 days.

Average time to hatching: 5 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Male longear sunfish guard their nest territories during all phases of reproduction. They will continuously chase both their own and other species out of their nesting territories. Males will continue to guard their nests even after all the young have left.

Parental Investment: pre-fertilization (Protecting: Male, Female); pre-hatching/birth (Protecting: Male)

  • Becker, G. 1983. Fishes of Wisconsin. Madison: The University of Wisconsin Press.
  • Goddard, K., A. Mathis. 1997b. Do opercular flaps of male longear sunfish (*Lepomis megalotis*) serve as sexual ornaments during female mate choice?. Ethology Ecology & Evolution, 9(3): 223-231.
  • Goddard, K., A. Mathis. 2000. Opercular Flaps as Sexual Ornaments for Male Longear Sunfish (*Lepomis megalotis*): Male Condition and Male-Male Competition. Ethology, 106: 631-643.
  • Huck, L., G. Gunning. 1967. Behavior of the Longear Sunfish, *Lepomis megalotis* (Rafinesque). Tulane Studies in Zoology, 14(3): 121-131.
  • Jennings, M., D. Philipp. 1992a. Female choice and male competition in longear sunfish. Behavioral Ecology, 3(1): 84-94.
  • Keenleyside, M. 1967. Behavior of Male Sunfishes (Genus *Lepomis*) Toward Females of Three Species. Evolution, 21(4): 688-695.
  • Miller, H. 1963. The Behavior of the Pumpkinseed Sunfish, *Lepomis gibbosus* (Linneaus), with Notes on the Behavior of Other Species of *Lepomis* and the Pigmy Sunfish, *Elassoma evergladei*. Behaviour, 22(1/2): 88-151.
  • Moyle, P., J. Cech Jr.. 1988. Fishes: an introduction to Ichthyology, 2nd edition. Englewood Cliffs: Prentice Hall.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Goddard and Mathis (1997b) found that female longear sunfish prefer male longears with longer opercular flaps, and they found that opercular flaps grew significantly faster than pelvic fins in males, both of which they argue indicate flap length serves as sexual ornamentation.

Goddard and Mathis (2000) also performed experiments where they artificially manipulated the lengths of male flaps. If a male with long flaps had his artificially shortened, he still archived dominance over males with naturally short flaps. If opercular flaps were artificially lengthened, the abnormally long-flapped males were dominant significantly more often than the ‘normal’ males. They argue that these results indicate that opercular flap length of male longear sunfish may serve as an honest indicator of male quality and may be used to assess the resource holding power of rival males without risking injury from combat.

When a breeding female enters a nesting colony, a male longear sunfish will attempt to lead her to its nest. Leading involves behavior where the male spreads its fins, swims directly toward the female and then returns directly to his nest. If a female follows the male to his nest, they begin a circular spiral of the nest with the female always toward the center. Direction of movement is dependant on which direction the male is going when he reenters the nest after chasing out an intruder. Both will circle the nest in an upright position, every 50 to 60 seconds the female will turn over on her side at a 20° to 30° angle and bring her vent close to his and both fish will shudder, releasing his sperm and her eggs. Several spawning events will occur and then the female is chased from the nest. In one study, the total number of eggs deposited in a nest varied from about 137 to 2,836 eggs.

Immediately after the female leaves, the male begins to fan the nest with his paired and caudal fins. He then assumes a near vertical position over the nest and fans with his tail. The fanning is vigorous enough to dislodge small pebbles. He will fan the nest up to an hour after the spawning event. This behavior may aid in the mixing of eggs and sperm and help drive the eggs deep into the gravel. The female, after being chased from the nest, will enter the nests of other males for additional spawning events.

Mating System: polyandrous

Like most other members of Lepomis, longear sunfish are colonial nesters, although in low-density populations individuals will build solitary nests. Colony size and proximity of the nests vary. In crowded conditions the colonies can be quite large with the nests so close together their rims almost touch. In dense conditions the male fish only defends the nest itself. In less dense conditions, the nests are further apart and the male will guard a territory slightly larger than the nest.

Male longear sunfish, like other members of Lepomis build the nest without aid from the female. In late spring or early summer, males move into relatively shallow water (20 to 60 cm deep) and establish territories in which they build nests. Preferred substrate is gravel if available; otherwise, they will build in sand or hard mud. The nest is a mostly circular excavation created by the vigorous sweeping of the male’s tail (called tail-wags) across the substrate while the fish is oriented at a 45° angle to the bottom. This action excavates a circular depression that is about 35 to 45 cm in diameter, 3 to 7 cm deep, with rims 7 to 9 cm wide. During the construction of one nest, a male was observed making 145 tail-wags in the center of the nest, 128 tail-wags along the edge, and 22 tail-wags across the nest. In addition, the male circled the nest 14 times, circled back to deep waters 39 times, chased off other longear sunfish 36 times, and chased off other species 3 times. Water temperatures in the nest area are relatively warm and vary from approximately from 23° to 31° C. They will reoccupy nests abandoned by other sunfish.

Male longear sunfish also exhibit an interesting alternative reproductive strategy to nest building. Some males are sneakers. The sneaker male is generally younger and less colorful than a nest building (dominant) male. The sneaker male mimics the appearance of a female longear sunfish. The sneaker will hide near an active nest and dash into the nest and release sperm while the dominant male is spawning with a female. The satellite male is similar in age and appearance to the sneaker male, but instead of dashing into the nest, he will hover over a nest, acting the part of a non-threatening female, and slowly descend into the nest containing a courting pair of sunfish and, like the sneaker, release sperm during the spawning event. Male longear sunfish that build solitary nests have better success defending their nests from sneaker and satellite males than males with nests in colonies. Colonial nesting is believed to favor the existence of sneaker and satellite males because it allows these males access to breeding females.

Breeding season: Late May to late August

Range number of offspring: 137 to 2800.

Range time to hatching: 2 to 7 days.

Average time to hatching: 5 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

A male longear sunfish guards the nest territory during all phases of reproduction. He will continuously chase both his own and other species out of his nesting territory. He seems most territorially responsive to potential predators of himself or his young and to potential intruding spawners like the sneaker and satellite males discussed above. The males are less responsive to non-threatening fish like topminnows (family Fundulidae). During one 20 minute spawning event, a male was observed to leave the nest 15 times to chase after other longear sunfish. When the defending male leaves the nest while eggs are present, young longear sunfish, 5 to 10 cm in length, will invade the unguarded nest and eat the eggs. Aggressiveness of the nesting male has been shown to be highest when eggs and young are present and lowest before and after. The male will continue to guard the nest even after all the young have left.

Parental Investment: pre-fertilization (Protecting: Male, Female); pre-hatching/birth (Protecting: Male)

  • Becker, G. 1983. Fishes of Wisconsin. Madison: The University of Wisconsin Press.
  • Goddard, K., A. Mathis. 1997b. Do opercular flaps of male longear sunfish (*Lepomis megalotis*) serve as sexual ornaments during female mate choice?. Ethology Ecology & Evolution, 9(3): 223-231.
  • Goddard, K., A. Mathis. 2000. Opercular Flaps as Sexual Ornaments for Male Longear Sunfish (*Lepomis megalotis*): Male Condition and Male-Male Competition. Ethology, 106: 631-643.
  • Huck, L., G. Gunning. 1967. Behavior of the Longear Sunfish, *Lepomis megalotis* (Rafinesque). Tulane Studies in Zoology, 14(3): 121-131.
  • Jennings, M., D. Philipp. 1992a. Female choice and male competition in longear sunfish. Behavioral Ecology, 3(1): 84-94.
  • Keenleyside, M. 1967. Behavior of Male Sunfishes (Genus *Lepomis*) Toward Females of Three Species. Evolution, 21(4): 688-695.
  • Miller, H. 1963. The Behavior of the Pumpkinseed Sunfish, *Lepomis gibbosus* (Linneaus), with Notes on the Behavior of Other Species of *Lepomis* and the Pigmy Sunfish, *Elassoma evergladei*. Behaviour, 22(1/2): 88-151.
  • Moyle, P., J. Cech Jr.. 1988. Fishes: an introduction to Ichthyology, 2nd edition. Englewood Cliffs: Prentice Hall.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spawning occurs in late spring and summer. This species often breeds in colonies of closely spaced nests. Eggs hatch in about 3-5 days. Males guard eggs and hatchlings (for up to a week or more after hatching). Individuals become sexually mature in 2nd or 3rd summer (Becker 1983, Manooch 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lepomis megalotis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 26 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTGGTATTTGGTGCATGAGCCGGGATGGTAGGCACAGCCCTAAGCCTACTAATTCGAGCAGAGCTCAGTCAACCCGGCGCCCTCCTTGGGGATGACCAAATTTATAACGTAATTGTAACGGCGCATGCATTCGTAATAATTTTCTTTATAGTAATGCCAATCATGATTGGAGGCTTCGGCAACTGGCTAGTCCCTTTAATAATTGGCGCCCCCGATATAGCCTTCCCCCGAATAAACAACATAAGTTTTTGACTTCTTCCCCCCTCTTTCCTCCTCCTCCTCGCCTCCTCCGGGGTCGAAGCCGGGGCTGGCACAGGCTGAACAGTGTACCCCCCTCTCGCCGGCAACCTCGCCCATGCAGGGGCATCCGTCGACCTTACTATTTTCTCTTTACACCTCGCAGGGGTATCTTCAATCCTCGGAGCTATCAATTTCATCACCACAATTATTAATATGAAACCTCCTGCTATTTCCCAGTATCAAACACCCCTCTTTGTCTGATCTGTACTAATCACTGCCGTCTTACTTCTACTCTCCCTCCCCGTCCTTGCTGCAGGAATCACTATACTCCTAACAGATCGTAACCTTAACACCACCTTCTTCGACCCGGCGGGGGGAGGAGACCCGATCCTCTACCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lepomis megalotis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 26
Specimens with Barcodes: 36
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Longear sunfish are not listed federally or internationally as threatened or endangered. The species is listed as threatened (since 1979) by the state of Wisconsin. The species is not listed as threatened or endangered in any other state or province within its native range.

IUCN Red List of Threatened Species: no special status

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Longear sunfish are not listed federally or internationally as threatened or endangered. The species is listed as threatened (since 1979) by the state of Wisconsin. The species was not listed in any other state or province within its native range where a threatened and endangered species list (or similar) could be found on the web.

Lists checked: Alabama, Arkansas, Florida, Georgia, Illinois, Indiana, Iowa, Kentucky, Michigan, Minnesota, Missouri, New York, Ohio, Pennsylvania, Tennessee, Texas, Virginia, West Virginia, and Wisconsin. Lists not found: Kansas, Louisiana, Mississippi, Oklahoma, and Ontario, Canada.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Longear sunfish cause no known negative economic impact.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Longear sunfish have little economic importance. They are too small to be considered a food fish for humans. Fisherman generally throw them back due to their small size. The species has been successfully bred in captivity, and may be kept as pets and used for laboratory experiments.

Positive Impacts: pet trade ; research and education

  • Cross, F. 1967. Handbook of Fishes of Kansas. Lawrence: Museum of Natural History, University of Kansas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Longear sunfish cause no known negative economic impact.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Longear sunfish have little economic importance. They are too small to be considered a food fish for humans. They are aggressive feeders and readily take bait. Anglers generally throw them back due to their small size. The species has been successfully reared in aquaria, may be kept as pets, and used for laboratory experiments.

Positive Impacts: pet trade ; research and education

  • Cross, F. 1967. Handbook of Fishes of Kansas. Lawrence: Museum of Natural History, University of Kansas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Longear sunfish

The longear sunfish (Lepomis megalotis) is a species of freshwater fish in the sunfish family (family Centrarchidae) of order Perciformes. It is native to the an area of eastern North America stretching from the Great Lakes down to northeastern Mexico.

The longear sunfish reaches a maximum recorded length of about 24 cm (9.5 in), with a maximum recorded weight of 790 g (1.7 lb).

The species prefers densely vegetated, shallow waters in lakes, ponds, and sluggish streams. Its diet can include insects, aquatic invertebrates, and small fish.

While L. megalotis is readily caught by anglers, the fish are typically too small to be useful as food, and most anglers release them.

The genus Lepomis has a well-characterized mating behavior where parental care is done by the male. He makes and defends the nest.

Trade in the longear sunfish is restricted in Germany because of the potential for environmental damage caused by introduced sunfish species.

Longear Sunfish from the Coosa River near Wetumpka, Alabama (Released)
Male Longear Sunfish

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Variation and ranges of described subspecies are poorly understood (Page and Burr 1991). Jennings and Phillip (1992) found that the most morphologically distinct form (subspecies peltastes) is not genetically distinct from subspecies megalotis (based on allele frequencies), whereas populations distributed from the Missouri River basin to the Colorado River in Texas, for which the subspecific names breviceps and aquilensis are available, clustered as a distinct group and warrant further study; they found no evidence of a distinct form in the Ozark Highlands. Hybridizes extensively with other Lepomis (Lee et al. 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!