Overview

Comprehensive Description

Biology

Usually occurs over mud in vegetated lakes, ponds, swamps and quiet water areas of streams.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Native to Mississippi River and Great Lakes basins from western Pennsylvania to Minnesota, south to the Gulf Coast; Atlantic and Gulf drainages from Rappahannock River, Virginia, to Rio Grande, Texas and New Mexico (Page and Burr 1991). Known from a couple locations in southwestern Ontario, Canada (Crossman et al. 1996). Introduced widely in western U.S., including lower Colorado River drainage, and in portions of Atlantic slope.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Native to Mississippi River and Great Lakes basins from western Pennsylvania to Minnesota, south to the Gulf Coast; Atlantic and Gulf drainages from Rappahannock River, Virginia, to Rio Grande, Texas and New Mexico (Page and Burr 1991). Known from a couple locations in southwestern Ontario, Canada (Crossman et al. 1996). Introduced widely in western U.S., including lower Colorado River drainage, and in portions of Atlantic slope.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: Great Lakes and Mississippi River basins from western Pennsylvania to Minnesota in the USA, and south to the Gulf of Mexico; Atlantic and Gulf drainages from Rappahannock River in Virginia to Rio Grande in Texas and New Mexico, USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

U.S.A.; introduced elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 28 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 310 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

31.0 cm TL (male/unsexed; (Ref. 5723)); max. published weight: 1,110 g (Ref. 4699)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Lepomis gulosus
Catalog Number: USNM 373
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): A. Whipple
Year Collected: 1853
Locality: Rio Medina, Texas., Medina County, Texas, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Lepomis gulosus
Catalog Number: USNM 281
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): A. Whipple
Year Collected: 1853
Locality: Leon River. Texas., Texas, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Ponds, lakes, swamps, and streams of low gradient with mud or debris over bottom; a pool species in streams where it often is near beds of vegetation or other cover; weedy turbid areas of rivers and backwaters. Tolerant of low oxygen levels of polluted waters. Common in lowlands, uncommon in uplands (Page and Burr 1991). Eggs are laid in a bowl-like nest made by male often in sand or rubble bottom with thin covering of silt or detritus near a rock, stump, clump of vegetation, or similar object, at depths of 15 cm to 1.5 m. Nests usually are separated from one another.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Ponds, lakes, swamps, and streams of low gradient with mud or debris over bottom; a pool species in streams where it often is near beds of vegetation or other cover; weedy turbid areas of rivers and backwaters. Tolerant of low oxygen levels of polluted waters. Common in lowlands, uncommon in uplands (Page and Burr 1991). Eggs are laid in a bowl-like nest made by male often in sand or rubble bottom with thin covering of silt or detritus near a rock, stump, clump of vegetation, or similar object, at depths of 15 cm to 1.5 m. Nests usually are separated from one another.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; freshwater; pH range: 7.0 - 7.5; dH range: 10 - 20
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 7 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0.255 - 1

Graphical representation

Depth range (m): 0.255 - 1
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats small crustaceans, aquatic insect larvae, and (large individuals) crayfish and fishes (Moyle 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Usually occurs over mud in vegetated lakes, ponds, swamps and quiet water areas of streams (Ref. 3814, 10294). Feeds on fish and benthic invertebrates (Ref. 2939, 10294).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Spawns in spring and summer. Eggs hatch in 34.5 hours at 25-26 C. Sexually mature usually in 2nd or 3rd summer. Male guards and fans eggs. May spawn 2 or more times per season. See Moyle (1976), Becker (1983), and Sublette et al. (1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lepomis gulosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTAGTATTTGGTGCATGAGCCGGAATAGTAGGCACAGCCCTGAGCCTGCTCATTCGAGCAGAGCTCAGCCAACCGGGGGCCCTATTAGGTGACGACCAGATTTATAATGTAATTGTAACAGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGTTTTGGTAACTGACTTGTCCCGCTAATAATTGGCGCCCCTGACATGGCATTCCCCCGAATAAACAATATGAGCTTCTGACTTCTCCCCCCTTCTTTCCTACTCCTTCTAGCCTCCTCCGGAGTTGAAGCCGGTGCTGGCACGGGGTGGACCGTTTACCCCCCTCTCGCGGGCAATCTAGCCCACGCAGGGGCATCCGTTGACCTTACCATCTTCTCCCTTCATCTCGCGGGGGTCTCTTCAATCCTGGGGGCAATTAATTTTATTACTACAATTATTAATATAAAACCCCCTGCCATCTCCCAATACCAAACACCACTATTTGTTTGGTCCGTTCTAATTACCGCTGTCTTACTTCTACTGTCCCTGCCCGTTCTTGCAGCAGGAATTACAATACTATTGACGGACCGAAACCTTAATACCACCTTTTTTGACCCGGCAGGGGGCGGGGACCCCATTCTTTATCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lepomis gulosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N1 - Critically Imperiled

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, and lack of major threats. Trend over the past 10 years or three generations is uncertain but likely relatively stable, or the species may be declining but not fast enough to qualify for any of the threatened categories under Criterion A (reduction in population size).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of subpopulations and locations.

Total adult population size is unknown but relatively large.

Trend over the past 10 years or three generations is uncertain but likely relatively stable or slowly declining.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Localized threats may exist, but on a range-wide scale no major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Localized threats may exist, but on a range-wide scale no major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquaculture: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Warmouth

Not to be confused with Wrymouth.

The warmouth, warmouth sunfish, or warmouth bass, Lepomis gulosus, is a large sunfish found throughout the eastern United States. Other local names include molly, redeye, goggle-eye, red-eyed bream, stump knocker, and strawberry perch. The warmouth is not a rock bass.

Description[edit]

The adult warmouth is dark, with a mottled brown coloration. Its belly is generally golden, and the male has a bright-orange spot at the base of the dorsal fin. Three to five reddish-brown streaks radiate from the eyes, and the gill flaps are often red. It has three spines in the anal fin, 10 spines in the dorsal fin, and small teeth are present on the tongue. These fish range in size from 4 to 10 inches (10.2 to 25 cm), but can grow to over 12 inches (31 cm) in length, and weigh up to 2.25 pounds (1 kg). The warmouth is occasionally confused with the rock bass or green sunfish, both of which share its relatively large mouth and heavy body, though the warmouth tends to be a bit larger in size. A common myth is that the warmouth is a hybrid of largemouth bass and bluegill sunfish. The warmouth is a native sunfish species.

Distribution[edit]

Warmouth are found throughout much of the south in the Mississippi River drainage, from the Gulf and Atlantic coasts and northward to the Chesapeake Bay, and westward throughout Texas to the Rio Grande, and northward into the Great Lakes basin area.[1][2] The warmouth is a highly aggressive and hardy fish, and they can live in ponds, lakes, rivers, and backwater streams and can often survive in streams with low oxygen levels where other species of sunfish cannot. The species exists with breeding populations in southern portions of Canada. and likely has existed there for many years prior to being detected.[3]

Ecology[edit]

The primary diet of the warmouth consists of insects, crayfish, and other fishes.[1] They are sight feeders, and can survive in polluted, low-oxygenated waters where other sunfish cannot, like rock bass. The largest factor affecting warmouth density and biomass in Florida’s lakes is the availability of aquatic macrophytes, which allows the fish to ambush prey and use as areas to spawn.[4] The primary diet of young warmouth is microcrustaceans and aquatic insect lava, whereas larger specimens tend to mainly consume crayfish, freshwater shrimp, and other small fish.[5][6] Their predators include larger fish, snakes, turtles, alligators, and birds. The primary habitats the warmouth occupies are areas with ample vegetation as cover with slower-moving water, often around stumps, brush piles, and other dense entanglements that allow the warmouth the ability to ambush prey, yet escape larger predators that may threaten them.[1]

Life history[edit]

Spawning for the warmouth begins usually begins when water temperatures reach 21.1°C.[7] Their spawning often begins in May and lasts until July. Nests are primarily constructed on rock or gravel substrates, usually located in or near to some type of structure in the water column. Unlike most other Lepomis species, the warmouth does not nest in a colony unless ideal nesting habitat is limited. When in breeding condition, the males' eyes turn red. After the female lays her eggs, the male fertilizes the eggs and aggressively defends the nest, eggs and fry from any intruder-including other females. Males are most commonly found defending the nest for up to five days later until the fry have hatched.[1] Young warmouth spend most of their time hiding under benthic substrate available to avoid predators. Most are considered sexually mature after one year, but often the size of a fish indicates its maturity rather than time.[1] Males usually grow faster than females. Different habitat conditions also reflect the lifespan of the warmouth, which varies from three to eight years.[8]

The warmouth is an extremely adaptable species that can survive in many different conditions, in many river systems east of the Rocky Mountains. Often, the warmouth prefers habitats where slower-moving and often polluted water. The most common cause of concern for the warmouth is hybridization with other Lepomis spp. that often inhabit the same areas as the warmouth. The species known to hybridize with it are L. cyanellus and L. macrochirus, as well as largemouth bass Micropterus salmoides and black crappie Pomoxis nigromaculatus.[9][10] This does not seem to affect the overall health or longevity of the species.

Since warmouths are not migratory fish, their populations should be relatively easily monitored throughout much of their existing ranges. According to Warren,[2] there is no threat or current concern for the warmouth.

References[edit]

  1. ^ a b c d e Larimore, Kenneth D. 1957. Ecological Life History of the Warmouth Centrarchidae. Illinois Natural History Survey, Bulletin 27(1):1-83
  2. ^ a b Warren, L. W., Jr., B. M. Burr, S. J. Walsh, H. L. Bart, Jr., R. C. Cashner, D. A. Etnier, B. J. Freeman, B. R. Kuhajda, R. L. Mayden, H. W. Robison, S. T. Ross, and W. C. Starnes. 2000. Diversity, Distribution, and Conservation status of the native freshwater fishes of the southern United States. Fisheries 25(10):7-29.
  3. ^ Crossman, EJ; Simpson, RC. 1984. Warmouth, Lepomis-gulosus, a fresh-water fish new to Canada. Canadian Field-Naturalist. 98 (4): 496-498
  4. ^ Willis, D.J.; D.L. Watson; M.V. Hoyer; D.E. Canfield. 2009. Factors related to Warmouth Lepomis gulosus biomass and density in Florida lakes. Florida Scientist 72:3:218-226
  5. ^ Etnier, D. A., and W. C. Starnes. 1993. The fishes of Tennessee. University of Tennessee Press, Knoxville, TN.
  6. ^ Tumlison, Renn; Carroll, Christtian; Greenwood, Matt. 2007. Summer food habits of young grass pickerel Esox amercanious, warmouth Lepomis gulosus, and log perch Percino caprodes from a cove in Lake Ouachita, Garland County, Arkansas. Journal of the Arkansas Academy of Science 61:134-136
  7. ^ Ross, S. T. 2001. The Inland Fishes of Mississippi. University Press of Mississippi, Jackson. 624 pp.
  8. ^ Gatz, A.J., Jr.; S.M. Adams. 1994. Patterns of movements of centrachids in two warm-water streams in eastern Tennessee. Ecology of Freshwater Fish 3:1:35-48
  9. ^ Merriner, J.V. 1971. Egg size as a factor in intergeneric hybrid success of centrarchids. Trans. Amer. Fish Soc. 100(1):29-32.
  10. ^ Lee, D. S. 1980. Lepomis gulosus (Cuvier),Warmouth. pp. 595 in D. S. Lee, et al. Atlas of North American Freshwater Fishes. N. C. State Mus. Nat. Hist., Raleigh, i-r+854 pp

Crossman, EJ; Simpson, RC. 1984. Warmouth, Lepomis-gulosus, a fresh-water fish new to Canada.Canadian Field-Naturalist. 98 (4): 496-498.

Crossman, EJ; Huston, J; Campbell, RR. 1996. The status or the Warmouth, Chaenbryttus gulosus, in Canada. Canadian Field-Naturalist. 110 (3): 494-500.

Etnier, D. A., and W. C. Starnes. 1993. The fishes of Tennessee. University of Tennessee Press, Knoxville, TN.

Gatz, A.J., Jr.; S.M. Adams. 1994. Patterns of movements of centrachids in two warm water streams in eastern Tennessee. Ecology of Freshwater Fish 3:1:35-48.

Larimore, Kenneth D. 1957. Ecological Life History of the Warmouth Centrarchidae. Illinois Natural History Survey, Bulletin 27(1):1-83

Lee, D. S. 1980. Lepomis gulosus (Cuvier),Warmouth. pp. 595 in D. S. Lee, et al. Atlas of North American Freshwater Fishes. N. C. State Mus. Nat. Hist., Raleigh, i-r+854 pp

Merriner, J.V. 1971. Egg size as a factor in intergeneric hybrid success of centrarchids. Trans. Amer. Fish Soc. 100(1):29-32

Ross, S. T. 2001. The Inland Fishes of Mississippi. University Press of Mississippi, Jackson. 624 pp.

Texas Parks and Wildlife Department, http://www.tpwd.state.tx.us/huntwild/wild/species/war/

Tumlison, Renn; Carroll, Christtian; Greenwood, Matt. 2007. Summer food habits of young grass pickerel Esox amercanious, warmouth Lepomis gulosus, and log perch Percino caprodes from a cove in Lake Ouachita, Garland County, Arkansas. Journal of the Arkansas Academy of Science 61:134-136.

Warren, L. W., Jr., B. M. Burr, S. J. Walsh, H. L. Bart, Jr., R. C. Cashner, D. A. Etnier, B. J. Freeman, B. R. Kuhajda, R. L. Mayden, H. W. Robison, S. T. Ross, and W. C. Starnes. 2000. Diversity, Distribution, and Conservation status of the native freshwater fishes of the southern United States. Fisheries 25(10):7-29.

Willis, D.J.; D.L. Watson; M.V. Hoyer; D.E. Canfield. 2009. Factors related to Warmouth Lepomis gulosus biomass and density in Florida lakes. Florida Scientist 72:3:218-226.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly in genus Chaenobryttus. Reported to hybridize with Lepomis cyanellus, and L. macrochirus. Though the gender of the name Lepomis is feminine (see Bailey and Robins, 1988, Bull. Zool. Nomencl. 45(2):100), the 1991 AFS checklist (Robins et al. 1991) retained the masculine ending for gulosus and other species, pending a vote by the ICZN on a petition (by Etnier and Warren) to treat Lepomis as masculine for nomenclatural purposes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!