Overview

Comprehensive Description

Biology

Adults inhabit vegetated lakes and ponds, as well as vegetated pools of creeks and small rivers (Ref. 5723). They feed on small fishes and other vertebrates (Ref. 1998), as well as fish eggs (Ref. 2058). An introduced species in Europe which avoids swift waters and occurs in estuaries with a salinity up to 18.2 ppt (Ref. 59043). Reported in Europe to prey on a wide variety of invertebrates (Ref. 59043). Considered undesirable catch (Ref. 30578).
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lepomis gibbosus (Linnaeus, 1758)

Inland water: 31100-666 (1 spc.), 29.06.1998 , Gala Lake , Edirne , M. Ôzulug .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 44-44, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Pumpkinseeds, Lepomis gibbosus, are found natively in the Atlantic Slope drainages from New Brunswick to the Edisto River in South Carolina and also in the Great Lakes, Hudson Bay, and upper Mississippi basins from Quebec and New York west to southeastern Manitoba and North Dakota, and south to northern Kentucky and Missouri.

This species has also been widely introduced in Europe, Africa, and South America, as well as other areas of North America.

Biogeographic Regions: nearctic (Introduced , Native ); palearctic (Introduced ); ethiopian (Introduced ); neotropical (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Native to much of Atlantic slope from New Brunswick to Edisto River, South Carolina; Great Lakes, Hudson Bay, and upper Mississippi basins from Quebec and New York to southeastern Manitoba and North Dakota, and south to northern Kentucky and Missouri drainage; common (Page and Burr 1991). Widely introduced in western U.S., southern Canada, and Europe.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Native to much of Atlantic slope from New Brunswick to Edisto River, South Carolina; Great Lakes, Hudson Bay, and upper Mississippi basins from Quebec and New York to southeastern Manitoba and North Dakota, and south to northern Kentucky and Missouri drainage; common (Page and Burr 1991). Widely introduced in western U.S., southern Canada, and Europe.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Pumpkinseeds, Lepomis_gibbosus, are found natively in the Atlantic Slope drainages from New Brunswick to the Edisto River in South Carolina and also in the Great Lakes, Hudson Bay, and upper Mississippi basins from Quebec and New York west to southeastern Manitoba and North Dakota, and south to northern Kentucky and Missouri.

This species has also been widely introduced in Europe, Africa, and South America, as well as other areas of North America.

Biogeographic Regions: nearctic (Introduced , Native ); palearctic (Introduced ); ethiopian (Introduced ); neotropical (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Canada and U.S.A., introduced elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: New Brunswick in Canada to South Carolina in the USA; Great Lakes, Hudson Bay and upper Mississippi basins from Quebec and New York west to southeast Manitoba and North Dakota, and south to north Kentucky and Missouri. Widely introduced. Several countries report adverse ecological impact after introduction.
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Pumpkinseeds are deep-bodied and laterally compressed. They have brassy yellow to olive green sides that are densely covered with spots of bright copper or gold. The opercle flap has a distinctive crimson spot in a half-moon shape on the rear edge in adults. In young pumpkinseeds a pale spot on the opercle flap distinguishes them from other Centrarchidae.

Etnier and Starnes (1993) describe pumpkinseeds as having: lateral line scales 35 to 43, dorsal fin with 10 (10 to 11) soft rays, anal fin soft rays 9 to 10, pectoral fin rays 13 (12 to 14).

Young pumpkinseeds also have vertical chainlike bands down their sides with dark vertical bars between the primary bands. These help to differentiate them from other sunfishes. Lepomis gibbosus are most easily confused with redear sunfish, L. microlophus and bluegills, L. macrochirus.

Range mass: 620 (high) g.

Average mass: 171-286 g.

Range length: 254 (high) mm.

Average length: 152-203 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Downs, W., L. Wiland, E. White, S. Wittman. 2002. "University of Wisconsin Sea Grant Institute Fish of the Great Lakes" (On-line). Accessed October 26, 2005 at http://www.seagrant.wisc.edu/greatlakesfish/fpumpkinseed.html.
  • Etnier, D., W. Starnes. 1993. The Fishes of Tennessee. Knoxville: The University of Tennesse Press.
  • Smith, P. 1979. The Fishes of Illinois. Urbana & Chicago: University of Illinois Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Pumpkinseeds are deep-bodied and laterally compressed. They have brassy yellow to olive green sides that are densely covered with spots of bright copper or gold. The opercle flap has a distinctive crimson spot in a half-moon shape on the rear edge in adults. In young pumpkinseeds a pale spot on the opercle flap distinguishes them from other Centrarchidae.

Etnier and Starnes (1993) describe pumpkinseeds as having: lateral line scales 35 to 43, dorsal fin with 10 (10 to 11) soft rays, anal fin soft rays 9 to 10, pectoral fin rays 13 (12 to 14).

Young pumpkinseeds also have vertical chainlike bands down their sides with dark vertical bars between the primary bands. These help to differentiate them from other sunfishes. Lepomis_gibbosus are most easily confused with redear sunfish, L._microlophus and bluegills, L._macrochirus.

Range mass: 620 (high) g.

Average mass: 171-286 g.

Range length: 254 (high) mm.

Average length: 152-203 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Downs, W., L. Wiland, E. White, S. Wittman. 2002. "University of Wisconsin Sea Grant Institute Fish of the Great Lakes" (On-line). Accessed October 26, 2005 at http://www.seagrant.wisc.edu/greatlakesfish/fpumpkinseed.html.
  • Etnier, D., W. Starnes. 1993. The Fishes of Tennessee. Knoxville: The University of Tennesse Press.
  • Smith, P. 1979. The Fishes of Illinois. Urbana & Chicago: University of Illinois Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 10 - 12; Dorsal soft rays (total): 10 - 12; Analspines: 3; Analsoft rays: 8 - 11; Vertebrae: 28 - 30
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 40 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 400 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

40.0 cm TL (male/unsexed; (Ref. 5723)); max. published weight: 630 g (Ref. 4699); max. reported age: 12 years (Ref. 72493)
  • Hubbell, P.M. 1966 Pumpkinseed sunfish, in Inland Fisheries Management, Calhoun. Calif. Dept. Fish. Game. 402-404, 405-407. (Ref. 72493)
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Pumpkinseeds are freshwater fishes, like other members of the sunfish family, Centrarchidae. They prefer cool to moderately warm, clear water that is 1 to 2 m deep in areas with lots of vegetation for cover. The ideal water temperature for pumpkinseeds ranges from 21 to 24 degrees Celsius.

Average depth: 1 to 2 m.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

Wetlands: marsh

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Lakes, reservoirs, ponds, sloughs, and sluggish streams; prefers quiet, clear water with aquatic vegetation and some organic debris. May occur in large numbers in shallow sheltered situations. Eggs are laid in a nest constructed by the male in shallow water (less than 1 m deep) in bottoms of sand, gravel, or woody debris.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Lakes, reservoirs, ponds, sloughs, and sluggish streams; prefers quiet, clear water with aquatic vegetation and some organic debris. May occur in large numbers in shallow sheltered situations. Eggs are laid in a nest constructed by the male in shallow water (less than 1 m deep) in bottoms of sand, gravel, or woody debris.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pumpkinseeds are freshwater fishes, like other members of the sunfish family, Centrarchidae. They prefer cool to moderately warm, clear water that is 1 to 2 m deep in areas with lots of vegetation for cover. The ideal water temperature for pumpkinseeds ranges from 21 to 24 degrees Celsius.

Average depth: 1 to 2 m.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

Wetlands: marsh

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; potamodromous (Ref. 51243); freshwater; pH range: 7.0 - 7.5; dH range: 10 - 15
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 226 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0.055 - 11.5

Graphical representation

Depth range (m): 0.055 - 11.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Pumpkinseeds consume a diverse diet of small prey including insects, insect larvae, mollusks, snails, crustaceans, leeches, and small fish. They are effective at destroying mosquito larvae and also consume detritus and small amounts of aquatic vegetation.

L. gibbosus feed at all water levels throughout the day, with their heaviest feeding occurring during the afternoon.

Animal Foods: fish; eggs; insects; mollusks; terrestrial worms; aquatic crustaceans; zooplankton

Plant Foods: leaves; algae

Other Foods: detritus

Primary Diet: carnivore (Insectivore , Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurs in quiet and vegetated lakes, ponds, and pools of creeks and small rivers. Feeds mainly on worms, crustaceans and insects (Ref. 7020) but may also feed on small fishes and other vertebrates (Ref. 1998), as well as fish eggs (Ref. 2058).
  • Maitland, P.S. and R.N. Campbell 1992 Freshwater fishes of the British Isles. HarperCollins Publishers, London.368 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats snails, aquatic insects, and other invertebrates obtained from bottom or from plant surfaces; pharyngeal jaws are specialized for crushing hard-shelled prey; larvae eat zooplankton (Moyle 1976, Becker 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Pumpkinseeds consume a diverse diet of small prey including insects, insect larvae, mollusks, snails, crustaceans, leeches, and small fish. They are effective at destroying mosquito larvae and also consume detritus and small amounts of aquatic vegetation.

Lepomis gibbosus feed at all water levels throughout the day, with their heaviest feeding occurring during the afternoon.

Animal Foods: fish; eggs; insects; mollusks; terrestrial worms; aquatic crustaceans; zooplankton

Plant Foods: leaves; algae

Other Foods: detritus

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Pumpkinseeds are a vital intermediate link in the food chain. They are an important prey species for birds and larger fish predators. They also impact the insect populations through consumption.

Pumpkinseeds are considered a pest in many areas where they have been introduced. Several countries have reported an adverse ecological impact after their introduction. Pumpkinseeds hybridize readily with most other Lepomis, especially with bluegill and green sunfish. The result is hybrids that are fast-growing, sterile males. This causes overcrowding and stunted growth in endemic species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pumpkinseeds inhabit dense vegetation to remain hidden from predators. Spines of the dorsal fins and anal fins on pumpkinseeds are spread out when they perceive danger, thus making them harder to swallow.

Known predators of pumpkinseeds include Sander vitreus (walleye), Micropterus salmoides (largemouth bass), Perca flavescens (yellow perch), Esox lucius (northern pike), Esox masquinongy (muskellunge), Amia calva (bowfin), Anguilla rostrata (American eel), other muskies (Esox), other sunfish (Centrarchidae), including other pumpkinseeds, mergansers (Lophodytes and Mergus), cormorants (Phalacrocorax), herons (Ardeidae), and humans (Homo sapiens).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Pumpkinseeds are a vital intermediate link in the food chain. They are an important prey species for birds and larger fish predators. They also impact the insect populations through consumption.

Pumpkinseeds are considered a pest in many areas where they have been introduced. Several countries have reported an adverse ecological impact after their introduction. Pumpkinseeds hybridize readily with most other Lepomis, especially with Lepomis macrochirus and Lepomis cyanellus. The result is hybrids that are fast-growing, sterile males. This causes overcrowding and stunted growth in endemic species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Pumpkinseeds inhabit dense vegetation to remain hidden from predators. Spines of the dorsal fins and anal fins on pumpkinseeds are spread out when they perceive danger, thus making them harder to swallow.

Known predators of pumpkinseeds include Stizostedion_vitreum (walleye), Micropterus_salmoides (largemouth bass), Perca_flavescens (yellow perch), Esox_lucius (northern pike), Esox_masquinongy (muskellunge), Amia_calva (bowfin), Anguilla_rostrata (American eel), other muskies (Esox), other sunfish (Centrarchidae), including other pumpkinseeds, mergansers (Lophodytes and Mergus), cormorants (Phalacrocorax), herons (Ardeidae), and humans (Homo_sapiens).

Known Predators:

  • Stizostedion_vitreum (walleye)
  • Micropterus_salmoides (largemouth bass)
  • Perca_flavescens (yellow perch)
  • Esox_lucius (northern pike)
  • Esox_masquinongy (muskellunge)
  • other muskies (Esox)
  • Amia_calva (bowfin)
  • Anguilla_rostrata (American eel)
  • other sunfish (Centrarchidae), including other pumpkinseeds
  • mergansers (Lophodytes and Mergus)
  • cormorants (Phalacrocorax)
  • herons (Ardeidae)
  • humans (Homo_sapiens)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Lepomis gibbosus (Lepomis gibbosus (pumpkinseed sunfish)) is prey of:
Salvelinus fontinalis

Based on studies in:
USA: New York, Bridge Brook (Lake or pond)

This list may not be complete but is based on published studies.
  • Havens K (1992) Scale and structure in natural food webs. Science 257:1107–1109
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

  • Havens K (1992) Scale and structure in natural food webs. Science 257:1107–1109
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: This species is represented by a large number of subpopulations and locations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total adult population size is unknown but very large.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Male pumpkinseeds change color during breeding season so it would appear that visual cues are important to either other males or females.

Communication Channels: visual ; tactile

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Male pumpkinseeds change color during breeding season so it would appear that visual cues are important to either other males or females.

Communication Channels: visual ; tactile

Perception Channels: visual

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

At 28 degrees Celsius the eggs of pumpkinseeds hatch in as little as three days. The normal range for eggs to hatch is 3 to 10 days. The newly hatched larvae are tiny and transparent. The eyes do not have any pigment in the first 48 hours after the larvae have hatched. They remain at the bottom of the nest for a short time. Male pumpkinseeds continue to guard larvae against predators for around 11 days when they become free-swimming. When they leave the nest the juvenile fish stay in or near the breeding area and can grow to around 50.8 mm in the first year of life. Pumpkinseeds usually reach sexual maturity at age 2.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Males build the nest on very shallow waters near the shore. The pair then swims in a circular path over the nest and eggs and sperm is released in intervals. The male guards the eggs for about 7 days (Ref. 93240) and the young (to about 11 days after hatching), then prepares the nest for another spawning with the same or different females (Ref. 1998). In European waters, each male may spawn with several females in one nest and guard the nest until abandoned by larvae (Ref. 59043). Produces up to 1000 eggs (Ref. 1672).
  • Scott, W.B. and E.J. Crossman 1973 Freshwater fishes of Canada. Bull. Fish. Res. Board Can. 184:1-966. (Ref. 1998)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Development

At 28 degrees Celsius the eggs of pumpkinseeds hatch in as little as three days. The normal range for eggs to hatch is 3 to 10 days. The newly hatched larvae are tiny and transparent. The eyes do not have any pigment in the first 48 hours after the larvae have hatched. They remain at the bottom of the nest for a short time. Male pumpkinseeds continue to guard larvae against predators for around 11 days when they become free-swimming. When they leave the nest the juvenile fish stay in or near the breeding area and can grow to around 50.8 mm in the first year of life. Pumpkinseeds usually reach sexual maturity at age 2.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Pumpkinseeds typically live 5 to 6 years but have reached 12 years old in captivity. In the wild, however, most do not exceed 8 years old.

Average lifespan

Status: wild:
8 years.

Range lifespan

Status: captivity:
12 (high) years.

Typical lifespan

Status: wild:
5 to 6 years.

Average lifespan

Status: wild:
5-6 years.

Average lifespan

Status: captivity:
13.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Pumpkinseeds typically live 5 to 6 years but have reached 12 years old in captivity. In the wild, however, most do not exceed 8 years old.

Average lifespan

Status: wild:
8 years.

Range lifespan

Status: captivity:
12 (high) years.

Typical lifespan

Status: wild:
5 to 6 years.

Average lifespan

Status: wild:
5-6 years.

Average lifespan

Status: captivity:
13.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Male pumpkinseeds will defend their nests agressively against other fish by spreading their opercula, charging, biting, chasing, and on occasion, they will mouth-fight. Females come in from deeper waters and at first appear to be chased away from the nest but, after a considerable amount of chasing, the male attempts to drive her into his nest and the female will approach the nest.

When the male pumpkinseed gets the female in his nest they will swim in a circular path above the nest with their bellies touching. The male releases milt and the female releases her eggs at intervals and fertilization occurs. Female pumpkinseeds can spawn in more than one nest. Also more than one female can use the same nest. Occasionally two females will spawn with a male at the same time.

Mating System: polygynandrous (promiscuous)

Spawning occurs when water is between 13 to 28 degrees Celsius, during late spring to late summer, depending on location. A female between 2 to 5 years of age can produce anywhere from 4000 to 7000 eggs in a single season and a male will breed several times (every 11 days or so) through the season.

Male pumpkinseeds build a nest in very shallow weedy bays of lakes or near the shore of runs and pools of streams in colonies of 3 to 15 nest sites. Pumpkinseeds maintain larger territories than bluegill but they will sometimes build their nests among bluegill and other sunfish nests and the different species will interbreed. Average pumpkinseed nests are around 30 cm in diameter and 5 to 7 cm deep.

Eggs can hatch in 3 days at 28 degrees Celsius. After hatching, the larvae will stay around 5 days in the nest, getting their nutrients from the yolk sac. When the larvae are able to self-feed they have a fully developed mouth and partially developed fins. The pelvic fins are the last to complete development. Pumpkinseeds reach sexual maturity at 2 years of age.

Breeding interval: The male will continue to spawn every 11 days or so through the breeding season.

Breeding season: Spawning and nesting occurs anywhere from April to August depending on location.

Average number of offspring: 600 to 3000 eggs.

Average gestation period: 3 - 10 days.

Average time to independence: 10 - 11 days.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

Male pumpkinseeds guard and defend the nest until the fry have hatched and dispersed. Sometimes one male will guard two nests by moving back and forth between them. He will fan the nest with his fins to keep it clean and well-oxygenated until the larvae are able to feed on their own (usually around 10 to 11 days). Male pumpkinseeds will even return the fry to the nest in his mouth if they stray.

Parental Investment: pre-fertilization (Protecting: Male, Female); pre-hatching/birth (Protecting: Male); pre-weaning/fledging (Protecting: Male); pre-independence (Protecting: Male)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spawns in spring and summer; eggs hatch in about 3-5 days; male guards eggs; sexually mature in 2nd or 3rd year; may nest in colonies (Moyle 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Male pumpkinseeds will defend their nests agressively against other fish by spreading their opercula, charging, biting, chasing, and on occasion, they will mouth-fight. Females come in from deeper waters and at first appear to be chased away from the nest but, after a considerable amount of chasing, the male attempts to drive her into his nest and the female will approach the nest.

When the male pumpkinseed gets the female in his nest they will swim in a circular path above the nest with their bellies touching. The male releases milt and the female releases her eggs at intervals and fertilization occurs. Female pumpkinseeds can spawn in more than one nest. Also more than one female can use the same nest. Occasionally two females will spawn with a male at the same time.

Mating System: polygynandrous (promiscuous)

Spawning occurs when water is between 13 to 28 degrees Celsius, during late spring to late summer, depending on location. A female between 2 to 5 years of age can produce anywhere from 4000 to 7000 eggs in a single season and a male will breed several times (every 11 days or so) through the season.

Male pumpkinseeds build a nest in very shallow weedy bays of lakes or near the shore of runs and pools of streams in colonies of 3 to 15 nest sites. Pumpkinseeds maintain larger territories than Lepomis macrochirus but they will sometimes build their nests among Lepomis macrochirus and other sunfish nests and the different species will interbreed. Average pumpkinseed nests are around 30 cm in diameter and 5 to 7 cm deep.

Eggs can hatch in 3 days at 28 degrees Celsius. After hatching, the larvae will stay around 5 days in the nest, getting their nutrients from the yolk sac. When the larvae are able to self-feed they have a fully developed mouth and partially developed fins. The pelvic fins are the last to complete development. Pumpkinseeds reach sexual maturity at 2 years of age.

Breeding interval: The male will continue to spawn every 11 days or so through the breeding season.

Breeding season: Spawning and nesting occurs anywhere from April to August depending on location.

Average number of offspring: 600 to 3000 eggs.

Average time to hatching: 3 - 10 days.

Average time to independence: 10 - 11 days.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

Male pumpkinseeds guard and defend the nest until the fry have hatched and dispersed. Sometimes one male will guard two nests by moving back and forth between them. He will fan the nest with his fins to keep it clean and well-oxygenated until the larvae are able to feed on their own (usually around 10 to 11 days). Male pumpkinseeds will even return the fry to the nest in his mouth if they stray.

Parental Investment: pre-fertilization (Protecting: Male, Female); pre-hatching/birth (Protecting: Male); pre-weaning/fledging (Protecting: Male); pre-independence (Protecting: Male)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lepomis gibbosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 29 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTAGTATTTGGTGCATGGGCCGGAATGGTGGGCACAGCTTTAAGCCTACTTATTCGAGCAGAGCTCAGTCAACCCGGCGCCCTCCTTGGGGATGACCAAATTTATAACGTAATTGTTACGGCTCATGCTTTCGTAATAATCTTCTTTATAGTAATACCAATTATAATTGGAGGCTTTGGCAACTGACTCGTCCCACTAATAATTGGCGCCCCCGATATAGCATTCCCCCGAATGAACAACATAAGTTTTTGACTTCTCCCCCCTTCTTTCCTCCTCCTTCTCGCCTCCTCTGGGGTCGAAGCGGGGGCTGGCACGGGCTGAACCGTTTATCCCCCTCTCGCCGGCAACCTAGCCCACGCCGGAGCATCCGTTGATCTCACTATTTTCTCCTTGCATCTTGCAGGGGTTTCTTCAATTTTAGGGGCAATTAATTTCATCACCACAATCATCAATATAAAACCCCCTGCCATTTCCCAATACCAGACACCACTGTTTGTCTGGTCCGTATTAATCACTGCAGTTTTACTTCTGCTCTCCCTCCCAGTCCTTGCTGCAGGGATTACTATGCTCCTCACGGATCGCAATCTTAACACCACCTTCTTTGACCCGGCAGGAGGCGGGGATCCCATCCTCTACCAACATCTGTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lepomis gibbosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 40
Specimens with Barcodes: 102
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Pumpkinseeds are common and abundant in suitable habitat, populations are not considered at risk.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, and lack of major threats. Trend over the past 10 years or three generations is uncertain but likely relatively stable, or the species may be declining but not fast enough to qualify for any of the threatened categories under Criterion A (reduction in population size).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pumpkinseeds are common and abundant in suitable habitat, populations are not considered at risk.

IUCN Red List of Threatened Species: no special status

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of subpopulations and locations.

Total adult population size is unknown but very large.

Trend over the past 10 years or three generations is uncertain but likely relatively stable or slowly declining.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Localized threats may exist, but on a range-wide scale no major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Localized threats may exist, but on a range-wide scale no major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Pumpkinseeds cause no known negative economic impact.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pumpkinseeds have little economic importance. They are aggressive feeders and readily bite at most bait. This, paired with their excellent flavor, causes people to consider them a good 'panfish.' However, experienced anglers often throw them back due to their small size.

The species can be successfully kept in aquariums and may, therefore, be kept as pets or used for lab experiments as well.

Positive Impacts: pet trade ; food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Pumpkinseeds cause no known negative economic impact.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Pumpkinseeds have little economic importance. They are aggressive feeders and readily bite at most bait. This, paired with their excellent flavor, causes people to consider them a good 'panfish.' However, experienced anglers often throw them back due to their small size.

The species can be successfully kept in aquariums and may, therefore, be kept as pets or used for lab experiments as well.

Positive Impacts: pet trade ; food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: subsistence fisheries; gamefish: yes; aquarium: commercial
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
  • Mills, D. and G. Vevers 1989 The Tetra encyclopedia of freshwater tropical aquarium fishes. Tetra Press, New Jersey. 208 p. (Ref. 7020)
  • Vostradovsky, J. 1973 Freshwater fishes. The Hamlyn Publishing Group Limited, London. 252 p. (Ref. 9696)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Though the gender of the name LEPOMIS is feminine (see Bailey and Robins, 1988, Bull. Zool. Nomencl. 45(2):100), the 1991 AFS checklist (Robins et al. 1991) retained the masculine ending for GIBBOSUS and other species, pending a vote by the ICZN on a petition (by Etnier and Warren) to treat LEPOMIS as masculine for nomenclatural purposes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!