Overview

Comprehensive Description

Biology

Commonly found on vegetated bottoms, occasionally over rocky bottoms and in mangrove areas. Enters brackish water and even freshwaters. Often forms large aggregations. Feeds mainly on small animals, especially crustaceans, but also takes mollusks, worms and occasionally small fishes that are associated with the grassy habitat.
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The pinfish, Lagodon rhomboides, is one of several species of porgies inhabiting Florida waters. The body of L. rhomboides is oval and compressed, silvery olive to bluish-silver on the sides with yellow stripes (Carpenter 2002). A blackish spot is centered on the origin of the lateral line, and a series of 4 diffuse black bars extend from the head to the base of the caudal fin (Robins et al. 1986). The anal fin is yellow with a light blue border, and the pectoral and caudal fins are yellow. Usual fin ray counts are as follows: dorsal fin = 12 spines and 12 soft rays; anal fin = 11 soft rays (Carpenter 2002).
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 pp.
  • Carpenter, KE. 2002. Sparidae. pp. 1554-1674. In: The living marine resources of the Western Central Atlantic. Volume 3: Bony fishes part 2 (Opistognathidae to Molidae), sea turtles and marine mammals. Carpenter KE (Ed.). FAO species identification guide for fishery purposes and American Society of Ichthyologists and Herpetologists special publication no. 5. FAO, Rome. pp. 1375-2127.
  • FWCC. 2010. Marine Fisheries Information System 2009 Annual Landings Summary. Florida Fish & Wildlife Conservation Commission. Online at http://research.myfwc.com/features/view_article.asp?id=19224 (Date accessed 08/24/2010).
  • Hansen, DJ. 1969. Food, growth, migration, reproduction, and abundance of pinfish, Lagodon rhomboides, and Atlantic croaker, Micropogon undulates, near Pensacola, Florida, 1963-65. Fish. Bull. 68: 135-146.
  • Harter, SL & KL Heck, Jr. 2006. Growth rates of juvenile pinfish (Lagodon rhomboides): effects of habitat and predation risk. Estuar. Coasts 29: 318-327.
  • Luczkovich, JJ, Norton, SF & RG Gilmore, Jr. 1995. The influence of oral anatomy on prey selection during the ontogeny of two percoid fishes, Lagodon rhomboides and Centropomus undecimalis. Environ. Biol. Fish. 44: 79-95.
  • Nelson, GA. 1998. Abundance, growth, and mortality of young-of-the-year pinfish, Lagodon rhomboides, in three estuaries along the gulf coast of Florida. Fish. Bull. 96: 315-328.
  • Nelson, GA. 2002. Age, growth, mortality, and distribution of pinfish (Lagodon rhomboides) in Tampa Bay and adjacent Gulf of Mexico waters. Fish. Bull. 100: 582-592.
  • Potthoff, MT & DM Allen. 2003. Site fidelity, home range, and tidal migrations of juvenile pinfish, Lagodon rhomboides, in salt marsh creeks. Environ. Biol. Fish. 67: 231-240.
  • Reber, CM & WA Bennett. 2007. The influence of thermal parameters on the acclimation responses of pinfish Lagodon rhomboides exposed to static and decreasing low temperatures. J. Fish Biol. 71: 833-841.
  • Shervette, VR, Ibarra, N & F Gelwick. 2007. Influences of salinity on growth and survival of juvenile pinfish Lagodon rhomboides (Linnaeus). Environ. Biol. Fish. 78: 125-134.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Cape Cod, Bermuda, and northern Gulf of Mexico to Florida Keys and Yucatan Peninsula; most common south of Cape Hatteras.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Massachusetts (USA), Bermuda, and northern Gulf of Mexico to Florida Keys, USA and Yucatan, Mexico. Also in northern coast of Cuba; absent in Bahamas or rest of Antilles
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Massachusetts (USA), Bermuda, and northern Gulf of Mexico to Florida Keys, USA and Yucatan, Mexico. Also in northern coast of Cuba; absent in Bahamas or rest of Antilles (Ref. 26938).
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The range of L. rhomboides extends from Massachusetts to the Florida Keys, and the northern Gulf of Mexico to the Yucatan and Cuba (Robins et al. 1986; Carpenter 2002). The species has also been documented from Bermuda and Jamaica, but records have been questioned and require verification (Carpenter 2002). Schools and solitary individuals can be found in a variety of coastal habitats from sheltered estuaries to nearshore reefs. Some studies have linked the predation and growth of larval and juvenile L. rhomboides to the type of habitat in which they reside (e.g. Harter & Heck, Jr. 2006). Seagrass beds and salt marshes act as nursery grounds for small pinfish, providing ample prey and substantial protective cover from predators. As juveniles, tagging studies have found that fishes exhibit a high degree of site fidelity in these habitats, with few individuals moving more than 20 m from their initial location (Potthoff & Allen 2003). Larger adults may venture to unvegetated areas and deeper water, eventually migrating offshore to spawn (e.g. Nelson 2002) (see 'Reproduction' below).Indian River Lagoon (India River Lagoon) Distribution: Little information is available concerning the distribution of the pinfish in the India River Lagoon, but the species is quite common and can be found throughout the lagoon on submerged tidal flats, in seagrass beds and salt marshes, among mangrove roots and in shallow nearshore waters off nearby sandy beaches.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 pp.
  • Carpenter, KE. 2002. Sparidae. pp. 1554-1674. In: The living marine resources of the Western Central Atlantic. Volume 3: Bony fishes part 2 (Opistognathidae to Molidae), sea turtles and marine mammals. Carpenter KE (Ed.). FAO species identification guide for fishery purposes and American Society of Ichthyologists and Herpetologists special publication no. 5. FAO, Rome. pp. 1375-2127.
  • FWCC. 2010. Marine Fisheries Information System 2009 Annual Landings Summary. Florida Fish & Wildlife Conservation Commission. Online at http://research.myfwc.com/features/view_article.asp?id=19224 (Date accessed 08/24/2010).
  • Hansen, DJ. 1969. Food, growth, migration, reproduction, and abundance of pinfish, Lagodon rhomboides, and Atlantic croaker, Micropogon undulates, near Pensacola, Florida, 1963-65. Fish. Bull. 68: 135-146.
  • Harter, SL & KL Heck, Jr. 2006. Growth rates of juvenile pinfish (Lagodon rhomboides): effects of habitat and predation risk. Estuar. Coasts 29: 318-327.
  • Luczkovich, JJ, Norton, SF & RG Gilmore, Jr. 1995. The influence of oral anatomy on prey selection during the ontogeny of two percoid fishes, Lagodon rhomboides and Centropomus undecimalis. Environ. Biol. Fish. 44: 79-95.
  • Nelson, GA. 1998. Abundance, growth, and mortality of young-of-the-year pinfish, Lagodon rhomboides, in three estuaries along the gulf coast of Florida. Fish. Bull. 96: 315-328.
  • Nelson, GA. 2002. Age, growth, mortality, and distribution of pinfish (Lagodon rhomboides) in Tampa Bay and adjacent Gulf of Mexico waters. Fish. Bull. 100: 582-592.
  • Potthoff, MT & DM Allen. 2003. Site fidelity, home range, and tidal migrations of juvenile pinfish, Lagodon rhomboides, in salt marsh creeks. Environ. Biol. Fish. 67: 231-240.
  • Reber, CM & WA Bennett. 2007. The influence of thermal parameters on the acclimation responses of pinfish Lagodon rhomboides exposed to static and decreasing low temperatures. J. Fish Biol. 71: 833-841.
  • Shervette, VR, Ibarra, N & F Gelwick. 2007. Influences of salinity on growth and survival of juvenile pinfish Lagodon rhomboides (Linnaeus). Environ. Biol. Fish. 78: 125-134.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 30 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 400 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

40.0 cm TL (male/unsexed; (Ref. 3815)); max. published weight: 1,510 g (Ref. 40637)
  • IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA. (Ref. 40637)
  • Randall, J.E. and R. Vergara 1978 Sparidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. Western Central Atlantic (Fishing Area 31). FAO, Rome. Vol. 5. pag.var. (Ref. 3815)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The maximum reported size of the pinfish is 40 cm, although lengths up to 18 cm are more common (Carpenter 2002). Based on otolith examinations of surveyed pinfish populations in Florida, age ranges are 0-7 years and 1-6 years for Tampa Bay and the Gulf of Mexico, respectively (Nelson 2002). The majority of individuals sampled were 2 years old or younger. Sexual maturity is reached between approximately 90 and 250 mm standard length, with average sizes documented at 130 cm for both sexes. Lifespan and growth rates vary with environmental conditions and other factors, but approximate growth rates for juvenile pinfish are 0.1-0.3 mm per day (Hansen 1969).
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 pp.
  • Carpenter, KE. 2002. Sparidae. pp. 1554-1674. In: The living marine resources of the Western Central Atlantic. Volume 3: Bony fishes part 2 (Opistognathidae to Molidae), sea turtles and marine mammals. Carpenter KE (Ed.). FAO species identification guide for fishery purposes and American Society of Ichthyologists and Herpetologists special publication no. 5. FAO, Rome. pp. 1375-2127.
  • FWCC. 2010. Marine Fisheries Information System 2009 Annual Landings Summary. Florida Fish & Wildlife Conservation Commission. Online at http://research.myfwc.com/features/view_article.asp?id=19224 (Date accessed 08/24/2010).
  • Hansen, DJ. 1969. Food, growth, migration, reproduction, and abundance of pinfish, Lagodon rhomboides, and Atlantic croaker, Micropogon undulates, near Pensacola, Florida, 1963-65. Fish. Bull. 68: 135-146.
  • Harter, SL & KL Heck, Jr. 2006. Growth rates of juvenile pinfish (Lagodon rhomboides): effects of habitat and predation risk. Estuar. Coasts 29: 318-327.
  • Luczkovich, JJ, Norton, SF & RG Gilmore, Jr. 1995. The influence of oral anatomy on prey selection during the ontogeny of two percoid fishes, Lagodon rhomboides and Centropomus undecimalis. Environ. Biol. Fish. 44: 79-95.
  • Nelson, GA. 1998. Abundance, growth, and mortality of young-of-the-year pinfish, Lagodon rhomboides, in three estuaries along the gulf coast of Florida. Fish. Bull. 96: 315-328.
  • Nelson, GA. 2002. Age, growth, mortality, and distribution of pinfish (Lagodon rhomboides) in Tampa Bay and adjacent Gulf of Mexico waters. Fish. Bull. 100: 582-592.
  • Potthoff, MT & DM Allen. 2003. Site fidelity, home range, and tidal migrations of juvenile pinfish, Lagodon rhomboides, in salt marsh creeks. Environ. Biol. Fish. 67: 231-240.
  • Reber, CM & WA Bennett. 2007. The influence of thermal parameters on the acclimation responses of pinfish Lagodon rhomboides exposed to static and decreasing low temperatures. J. Fish Biol. 71: 833-841.
  • Shervette, VR, Ibarra, N & F Gelwick. 2007. Influences of salinity on growth and survival of juvenile pinfish Lagodon rhomboides (Linnaeus). Environ. Biol. Fish. 78: 125-134.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

Both the pinfish and the sea bream, Archosargus rhomboidalis, bear a dark spot at the beginning of the lateral line. However, the spot is located below the line on the sea bream, but is centered on the lateral line on the pinfish (Robins et al. 1986). The anal and pelvic fins of A. rhomboidalis are orange, and the anal fin bears 10 soft rays.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 pp.
  • Carpenter, KE. 2002. Sparidae. pp. 1554-1674. In: The living marine resources of the Western Central Atlantic. Volume 3: Bony fishes part 2 (Opistognathidae to Molidae), sea turtles and marine mammals. Carpenter KE (Ed.). FAO species identification guide for fishery purposes and American Society of Ichthyologists and Herpetologists special publication no. 5. FAO, Rome. pp. 1375-2127.
  • FWCC. 2010. Marine Fisheries Information System 2009 Annual Landings Summary. Florida Fish & Wildlife Conservation Commission. Online at http://research.myfwc.com/features/view_article.asp?id=19224 (Date accessed 08/24/2010).
  • Hansen, DJ. 1969. Food, growth, migration, reproduction, and abundance of pinfish, Lagodon rhomboides, and Atlantic croaker, Micropogon undulates, near Pensacola, Florida, 1963-65. Fish. Bull. 68: 135-146.
  • Harter, SL & KL Heck, Jr. 2006. Growth rates of juvenile pinfish (Lagodon rhomboides): effects of habitat and predation risk. Estuar. Coasts 29: 318-327.
  • Luczkovich, JJ, Norton, SF & RG Gilmore, Jr. 1995. The influence of oral anatomy on prey selection during the ontogeny of two percoid fishes, Lagodon rhomboides and Centropomus undecimalis. Environ. Biol. Fish. 44: 79-95.
  • Nelson, GA. 1998. Abundance, growth, and mortality of young-of-the-year pinfish, Lagodon rhomboides, in three estuaries along the gulf coast of Florida. Fish. Bull. 96: 315-328.
  • Nelson, GA. 2002. Age, growth, mortality, and distribution of pinfish (Lagodon rhomboides) in Tampa Bay and adjacent Gulf of Mexico waters. Fish. Bull. 100: 582-592.
  • Potthoff, MT & DM Allen. 2003. Site fidelity, home range, and tidal migrations of juvenile pinfish, Lagodon rhomboides, in salt marsh creeks. Environ. Biol. Fish. 67: 231-240.
  • Reber, CM & WA Bennett. 2007. The influence of thermal parameters on the acclimation responses of pinfish Lagodon rhomboides exposed to static and decreasing low temperatures. J. Fish Biol. 71: 833-841.
  • Shervette, VR, Ibarra, N & F Gelwick. 2007. Influences of salinity on growth and survival of juvenile pinfish Lagodon rhomboides (Linnaeus). Environ. Biol. Fish. 78: 125-134.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Comments: Coastal waters; prefers areas with attached vegetation but also frequents other habitats with cover (rocky reefs, jetties, pilings). Widely eurythermal and euryhaline. Reported from fresh water in Florida, much more common at higher salinities. Spawns offshore; eggs are pelagic (Manooch 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; freshwater; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1679 specimens in 1 taxon.
Water temperature and chemistry ranges based on 623 samples.

Environmental ranges
  Depth range (m): 0 - 201
  Temperature range (°C): 10.269 - 25.997
  Nitrate (umol/L): 0.289 - 12.535
  Salinity (PPS): 33.112 - 36.472
  Oxygen (ml/l): 3.731 - 6.300
  Phosphate (umol/l): 0.092 - 0.998
  Silicate (umol/l): 0.756 - 4.888

Graphical representation

Depth range (m): 0 - 201

Temperature range (°C): 10.269 - 25.997

Nitrate (umol/L): 0.289 - 12.535

Salinity (PPS): 33.112 - 36.472

Oxygen (ml/l): 3.731 - 6.300

Phosphate (umol/l): 0.092 - 0.998

Silicate (umol/l): 0.756 - 4.888
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Migrates between offshore spawning habitat and inshore nonspawning habitat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats mostly worms, crustaceans, and mollusks found on or near rocks, pilings, and seagrasses (Manooch 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pinfish are omnivorous, feeding mostly during the day on a variety of vegetation, invertebrates and fishes (e.g. Nelson 1998). In terms of vegetation, small fishes feed primarily on diatoms, while larger adults consume filamentous algae and seagrasses (Hansen 1969). As juveniles, L. rhomboides employ a suction/ram-feeding method that develops into more of a biting behavior as the fishes increase in size (Luczkovich et al. 1995). Predators: Several species of fishes and wading birds likely prey on L. rhomboides. Especially as juveniles, pinfish seek refuge from predators in sheltered areas like seagrass beds (e.g. Harter & Heck, Jr. 2006).
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 pp.
  • Carpenter, KE. 2002. Sparidae. pp. 1554-1674. In: The living marine resources of the Western Central Atlantic. Volume 3: Bony fishes part 2 (Opistognathidae to Molidae), sea turtles and marine mammals. Carpenter KE (Ed.). FAO species identification guide for fishery purposes and American Society of Ichthyologists and Herpetologists special publication no. 5. FAO, Rome. pp. 1375-2127.
  • FWCC. 2010. Marine Fisheries Information System 2009 Annual Landings Summary. Florida Fish & Wildlife Conservation Commission. Online at http://research.myfwc.com/features/view_article.asp?id=19224 (Date accessed 08/24/2010).
  • Hansen, DJ. 1969. Food, growth, migration, reproduction, and abundance of pinfish, Lagodon rhomboides, and Atlantic croaker, Micropogon undulates, near Pensacola, Florida, 1963-65. Fish. Bull. 68: 135-146.
  • Harter, SL & KL Heck, Jr. 2006. Growth rates of juvenile pinfish (Lagodon rhomboides): effects of habitat and predation risk. Estuar. Coasts 29: 318-327.
  • Luczkovich, JJ, Norton, SF & RG Gilmore, Jr. 1995. The influence of oral anatomy on prey selection during the ontogeny of two percoid fishes, Lagodon rhomboides and Centropomus undecimalis. Environ. Biol. Fish. 44: 79-95.
  • Nelson, GA. 1998. Abundance, growth, and mortality of young-of-the-year pinfish, Lagodon rhomboides, in three estuaries along the gulf coast of Florida. Fish. Bull. 96: 315-328.
  • Nelson, GA. 2002. Age, growth, mortality, and distribution of pinfish (Lagodon rhomboides) in Tampa Bay and adjacent Gulf of Mexico waters. Fish. Bull. 100: 582-592.
  • Potthoff, MT & DM Allen. 2003. Site fidelity, home range, and tidal migrations of juvenile pinfish, Lagodon rhomboides, in salt marsh creeks. Environ. Biol. Fish. 67: 231-240.
  • Reber, CM & WA Bennett. 2007. The influence of thermal parameters on the acclimation responses of pinfish Lagodon rhomboides exposed to static and decreasing low temperatures. J. Fish Biol. 71: 833-841.
  • Shervette, VR, Ibarra, N & F Gelwick. 2007. Influences of salinity on growth and survival of juvenile pinfish Lagodon rhomboides (Linnaeus). Environ. Biol. Fish. 78: 125-134.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Although there are no obligate associations documented between the pinfish and other species, L. rhomboides is commonly found alongside other organisms from the various coastal marine and estuarine habitats in which it resides. For more extensive information on these ecosystems and their associated species found in and around the IRL, please visit Habitats of the IRL.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 pp.
  • Carpenter, KE. 2002. Sparidae. pp. 1554-1674. In: The living marine resources of the Western Central Atlantic. Volume 3: Bony fishes part 2 (Opistognathidae to Molidae), sea turtles and marine mammals. Carpenter KE (Ed.). FAO species identification guide for fishery purposes and American Society of Ichthyologists and Herpetologists special publication no. 5. FAO, Rome. pp. 1375-2127.
  • FWCC. 2010. Marine Fisheries Information System 2009 Annual Landings Summary. Florida Fish & Wildlife Conservation Commission. Online at http://research.myfwc.com/features/view_article.asp?id=19224 (Date accessed 08/24/2010).
  • Hansen, DJ. 1969. Food, growth, migration, reproduction, and abundance of pinfish, Lagodon rhomboides, and Atlantic croaker, Micropogon undulates, near Pensacola, Florida, 1963-65. Fish. Bull. 68: 135-146.
  • Harter, SL & KL Heck, Jr. 2006. Growth rates of juvenile pinfish (Lagodon rhomboides): effects of habitat and predation risk. Estuar. Coasts 29: 318-327.
  • Luczkovich, JJ, Norton, SF & RG Gilmore, Jr. 1995. The influence of oral anatomy on prey selection during the ontogeny of two percoid fishes, Lagodon rhomboides and Centropomus undecimalis. Environ. Biol. Fish. 44: 79-95.
  • Nelson, GA. 1998. Abundance, growth, and mortality of young-of-the-year pinfish, Lagodon rhomboides, in three estuaries along the gulf coast of Florida. Fish. Bull. 96: 315-328.
  • Nelson, GA. 2002. Age, growth, mortality, and distribution of pinfish (Lagodon rhomboides) in Tampa Bay and adjacent Gulf of Mexico waters. Fish. Bull. 100: 582-592.
  • Potthoff, MT & DM Allen. 2003. Site fidelity, home range, and tidal migrations of juvenile pinfish, Lagodon rhomboides, in salt marsh creeks. Environ. Biol. Fish. 67: 231-240.
  • Reber, CM & WA Bennett. 2007. The influence of thermal parameters on the acclimation responses of pinfish Lagodon rhomboides exposed to static and decreasing low temperatures. J. Fish Biol. 71: 833-841.
  • Shervette, VR, Ibarra, N & F Gelwick. 2007. Influences of salinity on growth and survival of juvenile pinfish Lagodon rhomboides (Linnaeus). Environ. Biol. Fish. 78: 125-134.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Lagodon rhomboides (Pinfish) is prey of:
Paralichthyes albigutta
Strongylura marina
Anatidae
Fundulus confluentus
Fundulus similis
Adinia xenica
Lophodytes cucullatus
Tringa melanoleuca
Catoptrophorus semipalmatus
sediment POC

Based on studies in:
USA: Florida (Estuarine)

This list may not be complete but is based on published studies.
  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

  • Christian RR, Luczkovich JJ (1999) Organizing and understanding a winter’s seagrass foodweb network through effective trophic levels. Ecol Model 117:99–124
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Detailed abundance records for L. rhomboides populations within the IRL are scarce. However, the species is extremely common throughout the lagoon and surrounding coastal waters.Reproduction &
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 pp.
  • Carpenter, KE. 2002. Sparidae. pp. 1554-1674. In: The living marine resources of the Western Central Atlantic. Volume 3: Bony fishes part 2 (Opistognathidae to Molidae), sea turtles and marine mammals. Carpenter KE (Ed.). FAO species identification guide for fishery purposes and American Society of Ichthyologists and Herpetologists special publication no. 5. FAO, Rome. pp. 1375-2127.
  • FWCC. 2010. Marine Fisheries Information System 2009 Annual Landings Summary. Florida Fish & Wildlife Conservation Commission. Online at http://research.myfwc.com/features/view_article.asp?id=19224 (Date accessed 08/24/2010).
  • Hansen, DJ. 1969. Food, growth, migration, reproduction, and abundance of pinfish, Lagodon rhomboides, and Atlantic croaker, Micropogon undulates, near Pensacola, Florida, 1963-65. Fish. Bull. 68: 135-146.
  • Harter, SL & KL Heck, Jr. 2006. Growth rates of juvenile pinfish (Lagodon rhomboides): effects of habitat and predation risk. Estuar. Coasts 29: 318-327.
  • Luczkovich, JJ, Norton, SF & RG Gilmore, Jr. 1995. The influence of oral anatomy on prey selection during the ontogeny of two percoid fishes, Lagodon rhomboides and Centropomus undecimalis. Environ. Biol. Fish. 44: 79-95.
  • Nelson, GA. 1998. Abundance, growth, and mortality of young-of-the-year pinfish, Lagodon rhomboides, in three estuaries along the gulf coast of Florida. Fish. Bull. 96: 315-328.
  • Nelson, GA. 2002. Age, growth, mortality, and distribution of pinfish (Lagodon rhomboides) in Tampa Bay and adjacent Gulf of Mexico waters. Fish. Bull. 100: 582-592.
  • Potthoff, MT & DM Allen. 2003. Site fidelity, home range, and tidal migrations of juvenile pinfish, Lagodon rhomboides, in salt marsh creeks. Environ. Biol. Fish. 67: 231-240.
  • Reber, CM & WA Bennett. 2007. The influence of thermal parameters on the acclimation responses of pinfish Lagodon rhomboides exposed to static and decreasing low temperatures. J. Fish Biol. 71: 833-841.
  • Shervette, VR, Ibarra, N & F Gelwick. 2007. Influences of salinity on growth and survival of juvenile pinfish Lagodon rhomboides (Linnaeus). Environ. Biol. Fish. 78: 125-134.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Feeding activity mostly diurnal (Manooch 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Spawns mid-October to March, mostly in December-January along most of southeastern U.S.; sexually mature in 1 or more years (Manooch 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Growth

Pinfish generally larger than 9 cm leave estuaries in the fall to spawn in oceanic waters (Hansen 1969). Females carry an average of 21,600 eggs, ranging in size from 0.09 to 0.66 mm in diameter, to be released and fertilized during spawning. Pelagic larvae are transported into estuaries, where they settle in shallow sheltered areas such as seagrass beds (Nelson 1998). On the Gulf coast of Florida, post-larval fish measuring 9-12 mm are found in November and December. As juveniles grow to adults, they move into deeper waters of the estuary and finally offshore again to reproduce.
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 pp.
  • Carpenter, KE. 2002. Sparidae. pp. 1554-1674. In: The living marine resources of the Western Central Atlantic. Volume 3: Bony fishes part 2 (Opistognathidae to Molidae), sea turtles and marine mammals. Carpenter KE (Ed.). FAO species identification guide for fishery purposes and American Society of Ichthyologists and Herpetologists special publication no. 5. FAO, Rome. pp. 1375-2127.
  • FWCC. 2010. Marine Fisheries Information System 2009 Annual Landings Summary. Florida Fish & Wildlife Conservation Commission. Online at http://research.myfwc.com/features/view_article.asp?id=19224 (Date accessed 08/24/2010).
  • Hansen, DJ. 1969. Food, growth, migration, reproduction, and abundance of pinfish, Lagodon rhomboides, and Atlantic croaker, Micropogon undulates, near Pensacola, Florida, 1963-65. Fish. Bull. 68: 135-146.
  • Harter, SL & KL Heck, Jr. 2006. Growth rates of juvenile pinfish (Lagodon rhomboides): effects of habitat and predation risk. Estuar. Coasts 29: 318-327.
  • Luczkovich, JJ, Norton, SF & RG Gilmore, Jr. 1995. The influence of oral anatomy on prey selection during the ontogeny of two percoid fishes, Lagodon rhomboides and Centropomus undecimalis. Environ. Biol. Fish. 44: 79-95.
  • Nelson, GA. 1998. Abundance, growth, and mortality of young-of-the-year pinfish, Lagodon rhomboides, in three estuaries along the gulf coast of Florida. Fish. Bull. 96: 315-328.
  • Nelson, GA. 2002. Age, growth, mortality, and distribution of pinfish (Lagodon rhomboides) in Tampa Bay and adjacent Gulf of Mexico waters. Fish. Bull. 100: 582-592.
  • Potthoff, MT & DM Allen. 2003. Site fidelity, home range, and tidal migrations of juvenile pinfish, Lagodon rhomboides, in salt marsh creeks. Environ. Biol. Fish. 67: 231-240.
  • Reber, CM & WA Bennett. 2007. The influence of thermal parameters on the acclimation responses of pinfish Lagodon rhomboides exposed to static and decreasing low temperatures. J. Fish Biol. 71: 833-841.
  • Shervette, VR, Ibarra, N & F Gelwick. 2007. Influences of salinity on growth and survival of juvenile pinfish Lagodon rhomboides (Linnaeus). Environ. Biol. Fish. 78: 125-134.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lagodon rhomboides

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 28 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTTGTATTTGGTGCTTGGGCCGGAATAGTAGGGACTGCCCTAAGTCTGCTTATTCGAGCAGAACTAAGCCAGCCCGGCGCTCTCCTAGGAGACGACCAGATTTATAATGTAATTGTTACAGCACATGCATTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGATTCGGAAACTGACTAATTCCACTAATGATCGGAGCCCCCGACATAGCATTCCCCCGAATAAATAACATGAGCTTCTGACTGCTGCCTCCGTCATTCCTCCTACTACTCGCCTCTTCCGGAGTCGAAGCTGGGGCCGGTACCGGCTGAACAGTCTACCCTCCATTGGCAGGAAATCTTGCCCATGCAGGAGCATCAGTTGACTTAACCATTTTCTCTCTCCACTTAGCTGGAATTTCATCTATTCTTGGTGCTATTAATTTTATTACCACCATTATCAATATGAAACCCCCCGCTATTTCACAGTATCAAACACCACTATTTGTATGAGCCGTTCTAATTACCGCCGTCCTGCTTCTCCTGTCTCTCCCAGTTCTTGCTGCCGGAATCACAATGCTTCTTACAGATCGAAATCTAAATACCACCTTCTTTGACCCAGCTGGAGGAGGAGACCCAATTCTCTATCAACATCTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lagodon rhomboides

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 28
Specimens with Barcodes: 48
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; bait: usually; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
  • Randall, J.E. and R. Vergara 1978 Sparidae. In W. Fischer (ed.) FAO species identification sheets for fishery purposes. Western Central Atlantic (Fishing Area 31). FAO, Rome. Vol. 5. pag.var. (Ref. 3815)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic & Ecological Importance: Although considered quite palatable, pinfish are rarely consumed because of their generally small size (Carpenter 2002). However, this species is the focus of a thriving bait fishery in Florida (Carpenter 2002; Nelson 2002). In 2009 alone, commercial landings for L. rhomboides exceeded 60,000 pounds, with estimated value of over $300,000 (FWCC 2010). Aside from its economic importance, the great numbers of species that either prey on or are consumed by L. rhomboides make the fish quite ecologically significant. In addition, pinfish serve as a vital link between primary and secondary production, consuming both vegetation and animal prey (Nelson 2002).
  • Robins CR, Ray GC, and J Douglas. 1986. A Field Guide to Atlantic Coast Fishes. The Peterson Field Guide Series. Houghton Mifflin Co., Boston. 354 pp.
  • Carpenter, KE. 2002. Sparidae. pp. 1554-1674. In: The living marine resources of the Western Central Atlantic. Volume 3: Bony fishes part 2 (Opistognathidae to Molidae), sea turtles and marine mammals. Carpenter KE (Ed.). FAO species identification guide for fishery purposes and American Society of Ichthyologists and Herpetologists special publication no. 5. FAO, Rome. pp. 1375-2127.
  • FWCC. 2010. Marine Fisheries Information System 2009 Annual Landings Summary. Florida Fish & Wildlife Conservation Commission. Online at http://research.myfwc.com/features/view_article.asp?id=19224 (Date accessed 08/24/2010).
  • Hansen, DJ. 1969. Food, growth, migration, reproduction, and abundance of pinfish, Lagodon rhomboides, and Atlantic croaker, Micropogon undulates, near Pensacola, Florida, 1963-65. Fish. Bull. 68: 135-146.
  • Harter, SL & KL Heck, Jr. 2006. Growth rates of juvenile pinfish (Lagodon rhomboides): effects of habitat and predation risk. Estuar. Coasts 29: 318-327.
  • Luczkovich, JJ, Norton, SF & RG Gilmore, Jr. 1995. The influence of oral anatomy on prey selection during the ontogeny of two percoid fishes, Lagodon rhomboides and Centropomus undecimalis. Environ. Biol. Fish. 44: 79-95.
  • Nelson, GA. 1998. Abundance, growth, and mortality of young-of-the-year pinfish, Lagodon rhomboides, in three estuaries along the gulf coast of Florida. Fish. Bull. 96: 315-328.
  • Nelson, GA. 2002. Age, growth, mortality, and distribution of pinfish (Lagodon rhomboides) in Tampa Bay and adjacent Gulf of Mexico waters. Fish. Bull. 100: 582-592.
  • Potthoff, MT & DM Allen. 2003. Site fidelity, home range, and tidal migrations of juvenile pinfish, Lagodon rhomboides, in salt marsh creeks. Environ. Biol. Fish. 67: 231-240.
  • Reber, CM & WA Bennett. 2007. The influence of thermal parameters on the acclimation responses of pinfish Lagodon rhomboides exposed to static and decreasing low temperatures. J. Fish Biol. 71: 833-841.
  • Shervette, VR, Ibarra, N & F Gelwick. 2007. Influences of salinity on growth and survival of juvenile pinfish Lagodon rhomboides (Linnaeus). Environ. Biol. Fish. 78: 125-134.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lagodon rhomboides

The pinfish, Lagodon rhomboides, is a saltwater fish of the Sparidae family, the breams and porgies. It inhabits mostly subtropical shallow coastal waters of the Atlantic and Gulf coasts of the United States and Mexico. [1] It is the only member of the monotypic genus Lagodon.[2] Other common names include pin perch, sand perch, and butterfish.[3]

Description[edit]

The pinfish is a small fish, growing only to about 4.5 in (11.4 cm). Both the male and the female have a silvery sheen with five to six vertical bars on the side. They have olive backs with yellow and white pigmentation and blue, green, and purple iridescence.[3] The anterior dorsal fin has 12 rigid, spiny rays capable of superficially puncturing human skin, giving the species its common name, pinfish.

Photo of a live pinfish, Lagodon rhomboides

Range[edit]

The pinfish is found in Bermuda and along the United States coast from Massachusetts to Texas, and down along the Mexican Gulf Coast. It is also found along the northern Yucatán coast and near some northern Caribbean islands, but it is less common in the tropical portions of its range.[1]

Habitat[edit]

The adult pinfish prefers waters between 30 and 50 feet deep, while the juvenile is more common where there is some cover, such as seagrass beds, rocky bottoms, jetties, pilings, and mangroves. It prefers higher-salinity water. It rarely schools, but it associates with other individuals, especially where food items such as barnacles are abundant.[3]

Diet[edit]

Pinfish undergo ontogenetic changes in the morphology of their dentition and gut tracts which affect diet throughout their life history. Juvenile pinfish are carnivorous and primarily eat shrimp, fish eggs, insect larvae, polychaete worms, and amphipods. As pinfish become older and larger they become increasingly more herbivorous, with plant matter comprising >90% of the diet for pinfish greater than 100mm.[3][citation needed]

Predators[edit]

The pinfish is prey for alligator gar, longnose gar, ladyfish, spotted sea trout, red drum, southern flounder, pelicans,[grouper], [cobia], and bottlenose dolphins.[3]

Reproduction[edit]

Sexual maturity is reached at about one year, when the fish is 80 to 100 mm in length. Spawning season is in the fall and winter. Eggs are broadcast in the water by the female, then fertilized by the male. The number of eggs varies from 7,000 to 90,000. They hatch after about 48 hours. Larvae are not protected by adults. The larval stage ends when the fish is about 12 mm in length, and the juvenile reaches maturity when it is about 80 mm. Because this species is eaten by many other animals, its life span is generally short.[3]

Human uses[edit]

The pinfish are not generally sought as sport or food in the United States due to its small size and numerous small bones. It is used as live bait by anglers targeting tarpon, red drum, spotted sea trout, and flounder. It is generally considered a nuisance bait-stealer.[3]

References[edit]

  1. ^ a b Froese, R. and D. Pauly, Eds. Lagodon rhomboides. FishBase. 2011.
  2. ^ Masterson, J. Lagodon rhomboides. Smithsonian Marine Station at Fort Pierce. National Museum of Natural History, Smithsonian Institution. 2008.
  3. ^ a b c d e f g Pinfish (Lagodon rhomboides). Texas Parks and Wildlife Department.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Monotypic; relationships within Sparidae are uncertain (Lee et al. 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!