Overview

Comprehensive Description

Biology

Pools, backwaters, and sluggish current over soft substrate in creeks and small to large rivers; oxbows, ponds, and impoundments (Ref. 5723, 10294).
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Yellow bullhead (Ameiurus natalis) range throughout the eastern United States, extending north to southeastern Canada and west to the Great Plains and Rio Grande drainage; they are introduced elsewhere (Etnier and Starnes, 1993).

Biogeographic Regions: nearctic (Native )

  • Etnier, D., W. Starnes. 1993. The Fishes of Tennesse. Knoxville, Tennesee: Univeristy of Tennesse Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Native throughout most of the eastern and central United States and adjacent southern Canada. Introduced widely outside native range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Yellow bullhead range throughout the eastern United States, extending north to southeastern Canada and west to the Great Plains and Rio Grande drainage; they have also been introduced in other places.

Biogeographic Regions: nearctic (Native )

  • Etnier, D., W. Starnes. 1993. The Fishes of Tennesse. Knoxville, Tennesee: Univeristy of Tennesse Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: Atlantic and Gulf slope drainages from New York to northern Mexico, and St. Lawrence-Great Lakes and Mississippi river basins from southern Quebec west to central North Dakota, and south to the Gulf. At least one country reports adverse ecological impact after introduction.
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southern Canada, central and eastern U.S.A. Introduced into other areas of eastern and western North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Yellow bullhead are ray-finned fish that lack scales. The dorsal part of the body can be yellow to olive, brown, mottled gray, or black. The belly is usually a yellow color. The caudal fin is rounded and unforked. Anal fin rays number 24 to 28; 25 to 26 is most common. Yellow bullhead may live to be 7 years old, and grow up to 45.7 to 48.3 centimeters long and weigh up to 3.2 kilograms.

Yellow bullhead are similar to black (Ameiurus melas) and brown (Ameiurus nebulosus) bullhead. They differ from these two species in that they have white or yellow chin barbels. Both black and brown bullhead have some dark pigmentation on the chin barbels. Fins and colorations are similar among the three species.

Average mass: 454 g.

Range length: 20.3 to 25.4 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Average mass: 1278 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Yellow bullhead are ray-finned fish that lack scales. The upper side of the body can be yellow to olive, brown, mottled gray, or black. The belly is usually a yellow color. The caudal (tail) fin is rounded and unforked. Yellow bullhead may live to be 7 years old, and grow up to 45.7 to 48.3 centimeters long and weigh up to 3.2 kilograms.

Yellow bullhead are similar to Ameiurus melas and Ameiurus nebulosus. They differ from these two species in that they have white or yellow chin barbels (that look like whiskers). Both black and brown bullhead have some dark color on the chin barbels.

Average mass: 454 g.

Range length: 20.3 to 25.4 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Average mass: 1278 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 470 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

47.0 cm TL (male/unsexed; (Ref. 5723)); max. published weight: 1,920 g (Ref. 4699); max. reported age: 4 years (Ref. 72462)
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
  • Altman, P.L. and D.S. Dittmer 1962 Growth, including reproduction and morphological development. Federation of American Societies for Experimental Biology. (Ref. 72462)
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Yellow bullhead prefer backwaters with slow current in rivers and streams. They can be found in the shallow parts of streams, lakes, ponds, or large bays. Habitat varies from a slow current with poorly oxygenated, highly silted, and highly polluted water to a more swift current with clean and clear water that has aquatic vegetation. Yellow bullhead are bottom dwellers, living in areas with muck, rock, sand, or clay substrates.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: benthic ; lakes and ponds; rivers and streams; temporary pools

  • Trautman, M. 1981. The Fishes of Ohio. Columbus, Ohio: Ohio St. University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This bullhead occurs in shallow, soft-bottomed, weedy parts of clear warm lakes, ponds, reservoirs, or slow-moving streams or canals. It is more tolerant of pollution than are most other ictalurids. Eggs are laid in saucer-shaper depressions beside or beneath banks, logs, or tree roost, or in burrows or under debris on the bottom (Becker 1983).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Yellow bullhead prefer backwaters with slow current in rivers and streams. They can be found in the shallow parts of streams, lakes, ponds, or large bays. Yellow bullhead can live in silty, polluted waters with slow current and low levels of oxygen clean, clear waters. Yellow bullhead are bottom dwellers, living in areas with muck, rock, sand, or clay substrates.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: benthic ; lakes and ponds; rivers and streams; temporary pools

  • Trautman, M. 1981. The Fishes of Ohio. Columbus, Ohio: Ohio St. University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; freshwater; depth range 10 - ? m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 31 specimens in 2 taxa.

Environmental ranges
  Depth range (m): 0.06 - 1.35

Graphical representation

Depth range (m): 0.06 - 1.35
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Like all other catfish species, yellow bullheads are opportunistic feeders. Yellow bullheads feed at night. They have been known to eat minnows, crayfish, insects and insect larvae, aquatic invertebrates, and worms. Compared to the other two bullheads, the yellow bullheads consume more aquatic vegetation. The young will feed on aquatic invertebrates.

Animal Foods: fish; carrion ; insects; mollusks; terrestrial worms; aquatic crustaceans

Plant Foods: macroalgae

Other Foods: detritus

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods, Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pools, backwaters, and sluggish current over soft substrate in creeks and small to large rivers; oxbows, ponds, and impoundments.
  • Marsh, P.C. and M.E. Douglas 1997 Predation by introduced fishes on endangered humpback chub and other native species in the Little Colorado River, Arizona. Trans. Am. Fish. Soc. 126(2):343-346. (Ref. 30595)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Like other Siluriformes species, yellow bullheads will eat almost anything that they can, including scavenging. Yellow bullheads feed at night. They have been known to eat minnows, crayfish, insects and insect larvae, aquatic invertebrates, and worms. Yellow bullheads also eat aquatic vegetation. The young will feed on aquatic invertebrates.

Animal Foods: fish; carrion ; insects; mollusks; terrestrial worms; aquatic crustaceans

Plant Foods: macroalgae

Other Foods: detritus

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Yellow bullheads have been found to be a host species for creepers (Strophitus undulatus) and they are parasitized by leeches (Hirudinea).

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Yellow bullheads are preyed upon by larger fish such as largemouth bass (Micropterus salmoides), black crappie (Pomoxis nigromaculatus), bluegill (Lepomis macrochirus) and other catfish. Large wading birds and some turtles will also take the adults. The young will be taken by smaller predators, aquatic invertebrates, leeches, and crayfish. They can inflict venomous stings with their pectoral spines, helping them to avoid predation.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Yellow bullheads are parasitized by leeches (Hirudinea) and the freshwater mussels, Strophitus undulatus, use them to help disperse their larvae. Yellow bullheads are also important predators and prey in the ecosystems in which they live.

Commensal/Parasitic Species:

  • creepers (Strophitus_undulatus)
  • leeches (Hirudinea)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Yellow bullheads are preyed upon by larger fish such as Micropterus salmoides, Pomoxis nigromaculatus, Lepomis macrochirus and other Siluriformes. Large wading birds and some turtles will also prey on adults. Young yellow bullheads can be eaten by smaller predators, like Odonata and Cambaridae. They can inflict a venomous sting with spines on their sides, this helps them to avoid predation.

Known Predators:

  • largemouth bass (Micropterus_salmoides)
  • black crappie (Pomoxis_nigromaculatus)
  • bluegill (Lepomis_macrochirus)
  • large wading birds (Aves)
  • turtles (Testudines)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Spiroxys Infestation. Parasitic infestations (protozoa, worms, etc.)
  • Bunkley-Williams, L. and E.H. Williams Jr. 2002 Nematodes of freshwater fishes of the Neotropical region. (Book review). Caribb. J. Sci. 38(3-4):289-294. (Ref. 46699)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spinitectus Infestation 3. Parasitic infestations (protozoa, worms, etc.)
  • Bunkley-Williams, L. and E.H. Williams Jr. 2002 Nematodes of freshwater fishes of the Neotropical region. (Book review). Caribb. J. Sci. 38(3-4):289-294. (Ref. 46699)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dichelyne Infestation. Parasitic infestations (protozoa, worms, etc.)
  • Bunkley-Williams, L. and E.H. Williams Jr. 2002 Nematodes of freshwater fishes of the Neotropical region. (Book review). Caribb. J. Sci. 38(3-4):289-294. (Ref. 46699)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Contracaecum Infestation 3. Parasitic infestations (protozoa, worms, etc.)
  • Bunkley-Williams, L. and E.H. Williams Jr. 2002 Nematodes of freshwater fishes of the Neotropical region. (Book review). Caribb. J. Sci. 38(3-4):289-294. (Ref. 46699)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Atema et al. (1969) and Todd (1971) have indicated that yellow bullheads are a very social fish and can recognize other individuals and their social status by their smell. The olfactory apparatus (i.e., nose) is responsible for this ability, while the barbels and other dermal taste buds are used for locating food (Etnier and Etnier, 2005).

Taste buds are found in the mouth and all over the body. Yellow bullheads have 5 taste buds every 5 mm² on their body surface. The barbels serve as both an external tongue and hands. Bullheads can feel with their body and their barbels. They also have 20,000 taste buds on the eight whiskers. The average adult has a total of over 200,000 taste buds on its body.

Communication Channels: visual ; tactile ; chemical

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Yellow bullheads are a very social fish and can recognize other yellow bullheads by their smell. They use their nose to smell and the "whiskers" and taste buds are used to find food. Taste buds are found in the mouth and all over the body. Yellow bullheads have 5 taste buds every 5 mm² of their body surface. The "whiskers" serve as both an external tongue and hands. Bullheads can feel with their body and their barbels. They also have 20,000 taste buds on the eight whiskers. The average adult has a total of over 200,000 taste buds on its body.

Communication Channels: visual ; tactile ; chemical

Perception Channels: visual

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Yellow bullhead eggs hatch five to ten days after fertilization. The male yellow bullhead guards the nest during this period. Upon hatching, the young fry are herded into tight schools by the male and protected until they are approximately two inches long. Sexual maturity is reached between the ages of 2 and 3 years, when the fish are at least 140 mm in length.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Development

Yellow bullhead eggs hatch five to ten days after fertilization. The male yellow bullhead guards the nest during this time. When they hatch the young fry are herded into tight schools by the male and protected until they are about two inches long. They are able to mate when they reach 2 to 3 years old or at least 140 mm in length.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Yellow bullheads have a 7 year life span in the wild.

Range lifespan

Status: wild:
7 (high) years.

Average lifespan

Status: wild:
4.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Yellow bullheads can live up to 7 years in the wild. Most yellow bullheads probably die when they are eggs, fry, or small fish.

Range lifespan

Status: wild:
7 (high) years.

Average lifespan

Status: wild:
4.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Yellow bullhead males dig nests, which may range from a shallow depression in muddy sediment to a deep burrow in the stream bank. Protected nest sites near rocks and stumps with dense vegetation are preferred. Nest sites attract females for mating.

Mating System: monogamous

Yellow bullhead spawn from April until June, beginning when water temperatures reach 23 to 28 degrees Celsius. The female produces 300 to 700 sticky yellowish eggs per spawning act, and the nest can contain 1700 to 4300 eggs in total.

Breeding interval: Yellow bullheads breed once yearly.

Breeding season: Yellow bullheads breed and spawn from April to July.

Range number of offspring: 1700 to 4300.

Average gestation period: 5-7 days.

Average age at sexual or reproductive maturity (female): 2-3 years.

Average age at sexual or reproductive maturity (male): 2-3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Average number of offspring: 500.

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Both the male and female help in the construction of the nest and while the young are in the nest one of the parents will guard them. After the fry hatch the male herds the young into a dense ball and will protect them until they grow to two inches long.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male); pre-independence (Protecting: Male)

  • Armstrong, P. 1962. Stages in the Development of Ictalurus nebulosus. Syracuse, New York: Syracuse Univeristy Press.
  • Eddy, S., T. Surber. 1943. Northern Fishes. Minneapolis, Minnesota: University of Minnesota Press.
  • Etnier, D., W. Starnes. 1993. The Fishes of Tennesse. Knoxville, Tennesee: Univeristy of Tennesse Press.
  • Hubbs, C., K. Lagler. 1958. Fishes of the Great Lakes Region. Ann Arbor, Michigan: University of Michigan Press.
  • 2005. "Ameiurus natalis (LeSueur)" (On-line). Kansas Fishes. Accessed October 15, 2005 at http://www.kansasfishes.com/Pages/yellowbullhead.htm.
  • Klossner, M. 2005. "No Bull" (On-line). Wisconsin Department of Natural Resources. Accessed October 15, 2005 at http://www.wnrmag.com/stories/1998/oct98/bull.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Yellow bullhead males dig nests, which might be a shallow depression in the mud to a deep burrow in the stream bank. They prefer nest sites that are protected by underwater vegetation or by rocks or stumps. Nest sites attract females for mating.

Mating System: monogamous

Yellow bullhead breed from April until June, beginning when water temperatures reach 23 to 28 degrees Celsius. The female produces 300 to 700 sticky yellowish eggs each time she breeds, and the nest can contain from 1700 to 4300 eggs altogether.

Breeding interval: Yellow bullheads breed once yearly.

Breeding season: Yellow bullheads breed and spawn from April to July.

Range number of offspring: 1700 to 4300.

Average time to hatching: 5-7 days.

Average age at sexual or reproductive maturity (female): 2-3 years.

Average age at sexual or reproductive maturity (male): 2-3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Average number of offspring: 500.

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Both the male and female help in the construction of the nest and, while the young are in the nest, one of the parents will guard them. After the fry hatch the male herds the young into a dense ball and will protect them until they grow to two inches long.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male); pre-independence (Protecting: Male)

  • Armstrong, P. 1962. Stages in the Development of Ictalurus nebulosus. Syracuse, New York: Syracuse Univeristy Press.
  • Eddy, S., T. Surber. 1943. Northern Fishes. Minneapolis, Minnesota: University of Minnesota Press.
  • Etnier, D., W. Starnes. 1993. The Fishes of Tennesse. Knoxville, Tennesee: Univeristy of Tennesse Press.
  • Hubbs, C., K. Lagler. 1958. Fishes of the Great Lakes Region. Ann Arbor, Michigan: University of Michigan Press.
  • 2005. "Ameiurus natalis (LeSueur)" (On-line). Kansas Fishes. Accessed October 15, 2005 at http://www.kansasfishes.com/Pages/yellowbullhead.htm.
  • Klossner, M. 2005. "No Bull" (On-line). Wisconsin Department of Natural Resources. Accessed October 15, 2005 at http://www.wnrmag.com/stories/1998/oct98/bull.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ameiurus natalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACGCGCTGATTTTTCTCAACCAACCACAAAGACATTGGCACCCTTTATCTCGTATTTGGTGCTTGAGCCGGAATAGTTGGCACAGCCCTTAGCCTGCTTATTCGGGCAGAGCTAGCCCAACCTGGTGCCCTCCTAGGCGAT---GATCAAATTTACAATGTTATTGTTACTGCCCACGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATTATAATCGGGGGATTTGGAAACTGACTTGTACCCCTTATGATTGGAGCCCCCGATATAGCTTTCCCCCGAATAAATAACATAAGCTTCTGACTCCTCCCCCCTTCTCTTCTCCTTCTACTAGCCTCCTCCGGAGTTGAAGCAGGAGCAGGAACAGGATGAACTGTTTACCCTCCACTTGCTGGTAACCTTGCACATGCGGGGGCCTCTGTAGACTTAACTATCTTTTCACTTCACCTTGCAGGGGTTTCATCTATTCTAGGGGCCATTAATTTTATTACAACTATTATCAACATAAAACCCCCCGCAATTTCACAATATCAGACGCCCCTATTTGTTTGAGCCGTTCTTATCACAGCCGTCCTCCTATTACTGTCCCTCCCAGTCTTAGCAGCTGGTATTACAATACTTCTTACTGATCGAAATTTAAACACCACATTCTTTGATCCAGCAGGAGGAGGGGACCCTATCTTATATCAACATCTTTTCTGATTCTTCGGGCACCCTGAAGTATATATTTTAATCTTGCCTGGCTTCGGCATGATTTCTCACATTGTTGCATATTATGCAGGCAAAAAGAAGCCATTCGGCTATATAGGAATGGTATGAGCTATAATAGCCATTGGCCTCCTGGGCTTCATCGTGTGAGCCCATCACATGTTTACAGTAGGCATGGATGTAGACACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ameiurus natalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Yellow bullheads are not known to have any specific conservation status.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large range extent, large population size, stable or increasing trend, and lack of major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Yellow bullhead populations are stable, they are not protected by any conservation listing.

IUCN Red List of Threatened Species: not evaluated

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a large number of occurrences (subpopulations).

Total adult population size is unknown but probably exceeds 1,000,000. Common in center of range (Page and Burr 2011).

Range and population size have increased over the long term as a result of introductions outside the native range.

Trend over the past 10 years or three generations: likely relatively stable.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research actions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Bullheads are very well known for the ability to inflict a sting with their pectoral spines. The pain can last for a week or more. The sting is caused by small glands near their fins that produce a poison which causes the swelling. The pain can be dulled by dabbing ammonia on the wound.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Yellow bullheads are not considered to be a game fish, but they are widely sought after for food. Yellow bullheads also can be introduced into streams with high pollution because of their high tolerance to pollution.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Bullheads are well known for the stings they can give you from the spines on their sides. The pain can last for a week or more. The sting is caused by small glands near their fins that produce a poison which causes the swelling. The pain can be dulled by dabbing ammonia on the wound.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Yellow bullheads are considered good to eat and are sought by fishermen. Yellow bullheads also can be introduced into dirty waters because of their high tolerance to pollution.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

gamefish: yes
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Yellow bullhead

Description[edit]

The yellow bullhead (Ameiurus natalis) is a species of bullhead catfish that is a ray-finned fish that lacks scales. This particular species is a medium sized member of the catfish family. It is typically yellow-olive to slatey-black on the back and sometimes mottled depending on habitat. The sides are lighter and more yellowish, while the underside of the head and body are bright yellow, yellow white, or bright white. The rear edge of its caudal fin is rounded. The anal fin is much larger than many fish having anywhere between 23 and 27 rays. The yellow bullhead though less common, can be easily distinguished from the brown bullhead and black bullhead by its white barbels or "whiskers". Yellow bullheads are medium-sized bullheads rarely getting larger than 2 lb (0.91 kg) but can reach up to 6.6 pounds, as documented by the International Game and Fish Association. This species is often misidentified on social media and the Internet. Yellow bullheads range in size from 6 to 18 inches and live up to 7 years.[citation needed]

Diet[edit]

The yellow bullhead is a voracious scavenger that will almost eat anything. It locates prey by brushing the stream bottom with its barbels. Taste buds on the barbels tell the bullhead whether or not contact is made with edible prey. They typically feed at night on a variety of plant and animal material, both live and dead, most commonly consisting of insects, snails, minnows, clams, crayfish, other small aquatic organisms, and decaying animal matter.

Habitat[edit]

Yellow bullhead are bottom dwellers, living in areas with muck, rock, sand, or clay substrates. Its habitat includes river pools, backwaters, and sluggish current over soft or mildly rocky substrate in creeks, small to larger rivers, and shallow portions of lakes and ponds. Their habitat can vary from a slow current with poorly oxygenated, highly silted, and highly polluted water to a more swift current with clean and clear water that has aquatic vegetation. Fishermen often find them in sluggish creeks and rivers with a gravel bottom.

Reproduction and Life Cycle[edit]

Bullheads have a monogamous relationship with spawning beginning in mid-May or early-June, with both sexes participating in nest-building. Bullheads usually use a natural cavities or make saucer shaped depressions near submerged cover, such as a trees roots or a sunken log. The female will lay anywhere from 300 to 7,000 eggs in a gelatinous mass, and after fertilization the male protects and continually fans the nest of eggs. The eggs hatch within five to 10 days and young fry are herded into tight schools by the male and protected by both parents until they are approximately two inches long. They grow to about 3 inches by one year of age. Sexual maturity is reached between the ages of 2 and 3 years, when the fish are at least 140 mm in length.

Distribution[edit]

Yellow bullhead range throughout the central and eastern US from central Texas, north into North Dakota, and east through the Great Lakes region to the East Coast. In Minnesota, Yellow bullheads are found on the eastern and central portions of the state and are absent in the top third of the state.

Importance to Humans[edit]

Yellow bullheads are considered a minor game fish, and they are sought after for food. Yellow bullheads also can be introduced into streams with high pollution because of their high tolerance to pollution. They are not as sought after as other catfishes, but are still a game fish providing many a great fishing trip.

Etymology[edit]

Named both Ictalurus natalis and Ameiurus natalis. Ictalurus, Greek, meaning "fish cat"; Ameiurus, Greek, meaning “privative curtailed,” in reference to the caudal fin lacking a notch; natalis, Latin, meaning “having large buttocks”

See also[edit]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!