Overview

Comprehensive Description

Biology

Found on coral reefs. Generally occurs solitarily or in pairs. Moves gracefully between seafans, seawhips, and corals (Ref. 9710). Stomach contents of 26 specimens indicate that the species feeds almost exclusively on sponges supplemented by small amounts of algae, tunicates, hydroids and bryozoans. Young pick ectoparasites from other fishes (Ref. 9710). Marketed fresh (Ref. 3797).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: Florida, USA and Gulf of Mexico to Brazil. Eastern Central Atlantic: St. Paul's Rocks (Ref. 13121).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is known in the Western Atlantic, from Florida (USA) and Gulf of Mexico to Brazil, the Caribbean including Antilles and south American coast, and in the Eastern Central Atlantic at St. Paul's Rocks (Brazil). It occurs at 1-70 m in depth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Queen angelfish, Holacanthus ciliaris, are tropical fish found in coral reefs in the western Pacific Ocean, the Indian Ocean, and the Atlantic Ocean as far south as Brazil. They do not migrate, and they are commonly spotted near the Bahamas and Florida.

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 14; Dorsal soft rays (total): 19 - 21; Analspines: 3; Analsoft rays: 20 - 21
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Queen angelfish are easily distinguished by their striking coloration, with vibrant yellow accents and variations of gem-like blues. Their distinctive "crown" is speckled dark blue and surrounded by a ring of bright blue. Their tail is yellow. Juveniles have a markedly different coloration than adults, displaying a striped blue and yellow pattern or a solid yellow pattern.

The body of queen angelfish is very flat, with an elongated, continuous dorsal and anal fin with 9 to 15 spines and 15 to 17 soft rays. They have a strong spine at the angle of the preopercle (cheek bone) and lack a well developed pelvic axillary process (fleshy bump at the base of the pelvic fin). Queen angelfish average 45 cm in length and 1.6 kg in mass. Males are generally larger than females.

Average mass: 1.6 kg.

Average length: 45 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: male larger

  • Nelson, J. 1994. Fishes of the World. New York, NY: John Wiley & Sons, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 450 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

45.0 cm TL (male/unsexed; (Ref. 4858)); max. published weight: 1,600 g (Ref. 26340)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Tail and pectoral fins entirely yellow. Black spot on forehead has electric blue spots and is surrounded by narrow, electric blue ring. Large blue spot at base of pectoral fin (Ref. 26938). Adults develop short spines on the margin. The color of large adults is purplish blue with yellow-orange rims to the scales; head above eye dark blue, below greenish yellow; mouth, chin, throat, chest and abdomen purplish blue (Ref. 13442)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Holacanthus iodocus
Catalog Number: USNM 47747
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: Galapagos Islands., Galapagos Islands, Pacific
Vessel: Albatross
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 1 - 70 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Found on coral and rocky reefs. Generally occurs solitarily or in pairs. Stomach contents of 26 specimens indicate that the species feeds almost exclusively on sponges supplemented by small amounts of algae, tunicates, hydroids and bryozoans. The young pick ectoparasites from other fishes.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Queen angelfish are primarily found in coral reefs, which provide shelter and abundant food sources. They can be found at depths up to 70 m. Although they are naturally marine fish, queen angelfish can tolerate changes in salinity. As such, they are often placed in marine aquariums.

Range depth: 70 (high) m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: reef

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 359 specimens in 1 taxon.
Water temperature and chemistry ranges based on 258 samples.

Environmental ranges
  Depth range (m): 0.5 - 73
  Temperature range (°C): 20.483 - 28.067
  Nitrate (umol/L): 0.115 - 3.505
  Salinity (PPS): 34.667 - 37.169
  Oxygen (ml/l): 4.285 - 4.773
  Phosphate (umol/l): 0.046 - 0.344
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 0.5 - 73

Temperature range (°C): 20.483 - 28.067

Nitrate (umol/L): 0.115 - 3.505

Salinity (PPS): 34.667 - 37.169

Oxygen (ml/l): 4.285 - 4.773

Phosphate (umol/l): 0.046 - 0.344

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 70m.
From 1 to 70 meters.

Habitat: reef-associated. Queen angelfish. Attains 45 cm. Blue and Semi-albinotic color morphs occur in St. Paul?s Rocks.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found on coral reefs. Moves gracefully between seafans, seawhips, and corals (Ref. 9710). Stomach contents of 26 specimens indicate that the species feeds almost exclusively on sponges supplemented by small amounts of algae, tunicates, hydroids and bryozoans. Omnivore (Ref. 57616).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Queen angelfish primarily feed on sponges and corals. They also eat other marine invertebrates, including tunicates, jellyfish, hydroids, bryozoans. They may also eat plankton and algae.

Animal Foods: cnidarians; other marine invertebrates; zooplankton

Plant Foods: algae

Primary Diet: carnivore (Eats other marine invertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Queen angelfishes feed on sponges, corals and other small invertebrates, and are preyed upon by larger animals that inhabit coral reefs.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Queen angelfish may be preyed upon by many larger fish that inhabit coral reefs; however, predation has not been well studied.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Queen angelfish communicate, particularly during mating, through temporary changes in color. Little information is otherwise available regarding the communication and perception of queen angelfish.

Communication Channels: visual

Perception Channels: visual

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

After fertilized eggs of queen angelfish float in the water column for 15 to 20 hours, they develop into transparent larvae. Larvae then develop into juveniles, which resemble adults. Larvae feed on plankton and grow rapidly, reaching a size of 15 to 20 mm in their juvenile form.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The lifespan of queen angelfish has not been well documented.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Queen angelfish are believed to be polygynous, and harems have been observed during courtship and pre-spawning. Harems generally consist of 1 male and up to 4 females. A male courts a female by displaying his pectoral fins, flicking them outward every few seconds. The female then ascends in the water, and the male positions himself below the female. The male touches his snout to her vent (genital) area, rising with the female with his belly close to hers. As the pair rises to about 18 m in depth, they release eggs and sperm.

Mating System: polygynous

Queen angelfish spawn seasonally, which occurs during the winter months in Puerto Rico. Spawning peaks once each year, although queen angelfish may spawn more than once during the year. Spawning behavior has been observed within minutes of sunset during the evening. Females can produce 25,000 to 75,000 eggs in one evening. Eggs hatch in 15 to 20 hours, and larvae absorb the yolk sac in the next 48 hours. Larvae feed on plankton and grow rapidly, reaching a size of 15 to 20 mm in their juvenile form.

Breeding interval: Spawning peaks once a year, but queen angelfish may spawn more than once during the year.

Breeding season: Queen angelfish spawn seasonally, which occurs during the winter in Puerto Rico.

Range time to hatching: 15 to 20 hours.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

Once eggs are fertilized, zygotes are left develop into larvae without any parental investment. Juvenile queen angelfish find protection among colonies of finger sponges and corals at the bottom of reefs.

Parental Investment: no parental involvement; pre-fertilization (Provisioning)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Holacanthus ciliaris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTACTATTCGGTGCTTGAGCTGGAATAGTGGGGACAGCTTTAAGCCTACTAATTCGAGCAGAATTAAATCAACCAGGCAGCCTCCTTGGGGACGACCAAATCTACAATGTTATCGTCACAGCACATGCATTTGTAATAATTTTTTTTATGGTCATACCCGCTATAATTGGGGGATTCGGAAACTGGCTAATTCCCCTAATAATTGGGGCCCCCGATATGGCATTCCCCCGAATGAACAACATAAGCTTTTGACTCCTTCCCCCCTCCCTTCTCCTTCTCCTAGCATCCGCCGGAGTTGAGGCCGGAGCCGGGACTGGATGAACAGTATATCCTCCCCTAGCCGGCAATCTAGCACATGCAGGTGCATCAGTAGATTTAACCATCTTCTCTCTCCATTTAGCCGGGGTTTCCTCAATTCTAGGGGCTATTAACTTTATCACAACCATCATCAACATGAAACCTCCCGCCATCTCGCAGTATCAGACACCCCTATTTGTCTGAGCAGTATTAATTACTGCAGTACTGCTACTTCTTTCCCTTCCAGTCCTTGCTGCGGGTATCACAATACTCTTAACAGACCGAAACCTGAACACTACCTTCTTTGACCCCGCAGGAGGAGGGGATCCGATTCTCTACCAGCACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Holacanthus ciliaris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Pyle, R., Myers, R., Rocha, L.A. & Craig, M.T.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification
Even though this species is harvested in high numbers in Brazil, it is not harvested much in other parts of its range (including the Caribbean), and population numbers are apparently stable globally. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Queen angelfish are considered a species of least concern by the ICUN. Populations are globally stable, although they are harvested in high numbers near Brazil.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is common around shallow reefs in the Caribbean and Brazil.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats

Collection by the aquarium trade is a local threat to some populations, however, there are no apparent major threats to the global population. The population at St. Paul's Rocks is potentially susceptible to overcollection. However, St. Paul's Rocks is a very isolated island, only accessible by boat, and is located 1,000 miles from the Brazilian coast. Thus, collection of specimens from this island is very expensive.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is present in numerous protected areas. A maximum quota of 10,000 specimens for export from Brazil has been established for this species, which exceeds the current collection levels.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse effects of queen angelfish on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Queen angelfish are popular additions to saltwater aquariums because of their beautiful coloration as both juveniles and adults. Because new technologies have allowed hobbyists to effectively care for and keep marine fish, queen angelfish are increasing sought after. In Florida, queen angelfish averaged from $11.16 to $17.84 USD per fish between 1990 and 1998. Retail prices vary with size and range between $60 and $130 USD. Adult mating pairs sell at a premium.

Positive Impacts: pet trade

  • Larkin, S., C. De Bodisco, R. Degner. 2008. Wholesale and Retail Break-Even Prices for MAC-Certified Queen Angelfish (Holancanthus Ciliaris). Pp. 125-138 in C Brown, J Cato, eds. Marine Ornamental Species: Collection, Culture & Conservation. Online: John Wiley & Sons, Inc.. Accessed April 04, 2010 at http://www3.interscience.wiley.com/cgi-bin/bookhome/117913832.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Queen angelfish

The queen angelfish (Holacanthus ciliaris) is an angelfish commonly found near reefs in the warmer sections of the western Atlantic Ocean. Other common names include blue angelfish, golden angelfish, queen angel, and yellow angelfish.[1]

Contents

Description [edit]

The adult queen angelfish overall body color can be described as blue to blue-green with yellow rims on its scales. Their pectoral and ventral fins are also yellow but their lips and the edges of their dorsal fins and anal fins are dark blue. Queen angelfish are also known to have blue markings around each gill cover. Juveniles have dark blue bodies with yellow lips, gills, and tail and vertical bars ranging in color from light blue to white. The colors of the juvenile fish help them to blend in with the reefs. The queen angelfish may live up to 15 years in the wild and reach up to 45 centimeters (17 inches) in length. Queen angelfish are about three and a half pounds.

Like other angelfish, much of its locomotion is produced by the pectoral fins. The outer 40% of each fin can be used to produce up to 80% of the fish's total thrust.[2]

Diet [edit]

The queen angelfish feeds primarily on sponges, but also feeds on tunicates, jellyfish, and corals as well as plankton and algae. Juveniles serve as "cleaners" and feed on the parasites of larger fish at cleaning stations. Although in home aquariums, aquarists have been successful in providing the queen angelfish a diet of meaty and algae based foods.

Distribution [edit]

Queen angelfish inhabit reefs and are common near Florida especially the Florida Keys, the Bahamas, and the Gulf of Mexico. It is rarely seen in the Bermuda Triangle and as far south as Brazil.

Reproduction [edit]

The adults are found in pairs year round, perhaps suggesting a long-term monogamous bond. The pairs reproduce by rising up in the water, bringing their bellies close together, and release clouds of sperm and eggs. The female can release anywhere from 25 to 75 thousand eggs each evening and as many as ten million eggs during each spawning cycle. The eggs are transparent, buoyant, and pelagic, floating in the water column. They hatch after 15 to 20 hours into larvae that lack effective eyes, fins, or even a gut. The large yolk sac is absorbed after 48 hours, during which time the larvae develop normal characteristics of free swimming fish. Larvae are found in the water column and feed on plankton. The larvae grow rapidly and about 3–4 weeks after hatching the 15–20 millimetres (0.6–0.8 in) long juvenile settles on the bottom.

In aquaria [edit]

The queen angelfish is considered to be moderate in difficulty to keep in captivity and is ill-suited for the inexperienced aquarist. They are an aggressive species that require a large aquarium. Most aquarists recommend a minimum tank size anywhere from 150 on up to 180 gallons. The queen angelfish will harass other fish without discrimination, particularly new additions to the aquarium. It should be the last fish added to any system. It is not a reef safe fish, and larger specimens may nip at or consume corals, particularly stony or soft ones, and ornamental invertebrates.

References [edit]

  1. ^ Pyle, R., et al. 2010. Holacanthus ciliaris. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2. Downloaded on 03 June 2013.
  2. ^ Blake, R. W. The Mechanics of Labriform Locomotion I. Labriform Locomotion in the Angelfish (Pterophyllum eimekei): An Analysis of the Power Stroke.

Further reading [edit]

  • Humann, P. and N. Deloach. Reef Fish Identification: Florida, Caribbean, Bahamas. New World Publications Inc. Jacksonville. pp. 20–21.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!