Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Usually found in the vicinity of coral reefs in protected waters such as bays or lagoons or in deeper outer-reef areas to at least 40 meters (Ref. 54393). Inhabits mixed sand, rubble, and seaweed covered bottoms. Carnivorous, feeds mainly on worms, crustaceans, brittle stars, and small mollusks and heart urchins.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Pacific: Moluccas and Philippines to western Samoa, north to the Ryukyu Islands, south to New Caledonia and Tonga; Palau, Caroline and Marshall Islands in Micronesia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Pacific and southeastern Indian Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8; Dorsal soft rays (total): 9; Analspines: 1; Analsoft rays: 7
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 300 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

30.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Diagnosis: Pectoral rays 15-16 (usually 15). Gill rakers 6-8 + 20-25 (total 28-32). Body moderately elongate, depth 3.2-3.5 in SL; head length 2.75-3.15 in SL; snout length 1.8-2.0 in HL; barbel length 1.3-1.5 in HL; head and anterior half of body reddish black, posterior half white and yellow with a black spot nearly as large as eye on upper side below rear base of second dorsal fin, followed by small blue spots; a white band from front of snout passing above eye along dorsal part of body, and a second nearly parallel one from corner of mouth to above pectoral fin; caudal fin pale yellow with a broad, dusky lower margin, and often with a small red spot at midbase; barbels red (Ref. 54393).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range ? - 40 m (Ref. 54393)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 92 specimens in 1 taxon.
Water temperature and chemistry ranges based on 73 samples.

Environmental ranges
  Depth range (m): 3.5 - 66.9273
  Temperature range (°C): 23.278 - 28.764
  Nitrate (umol/L): 0.171 - 2.380
  Salinity (PPS): 33.950 - 35.493
  Oxygen (ml/l): 4.230 - 4.703
  Phosphate (umol/l): 0.055 - 0.308
  Silicate (umol/l): 0.567 - 4.599

Graphical representation

Depth range (m): 3.5 - 66.9273

Temperature range (°C): 23.278 - 28.764

Nitrate (umol/L): 0.171 - 2.380

Salinity (PPS): 33.950 - 35.493

Oxygen (ml/l): 4.230 - 4.703

Phosphate (umol/l): 0.055 - 0.308

Silicate (umol/l): 0.567 - 4.599
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154). Inhabits mixed sand, rubble, and seaweed covered bottoms. Usually found in the vicinity of coral reefs in protected waters such as bays or lagoons. Carnivorous, feeds mainly on worms, crustaceans, brittle stars, and small mollusks and heart urchins
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Parupeneus barberinoides

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Parupeneus barberinoides

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTTATTTAATCTTCGGGGCCTGAGCCGGAATAGTTGGCACAGCCCTAAGTCTCCTTATTCGTGCCGAGCTCGGCCAGCCCGGGGCTCTTCTAGGCGACGATCAAATTTATAACGTCATCGTTACAGCCCACGCCTTTGTAATAATTTTCTTTATAGTGATGCCAATCATGATCGGGGGCTTCGGTAACTGACTCATCCCACTAATGATTGGGGCCCCCGACATGGCCTTCCCTCGGATGAACAACATGAGCTTTTGACTACTTCCCCCCTCCTTCCTTCTCCTGCTCGCCTCTTCAGGCGTTGAAGCTGGGGCAGGGACTGGTTGAACAGTCTACCCCCCTCTGGCCGGTAATCTAGCACACGCTGGAGCATCCGTTGACCTGACCATTTTCTCACTCCATCTGGCAGGTATCTCCTCCATCCTTGGGGCCATTAATTTTATTACTACCATTATCAACATGAAACCCCCAGCGATTTCACAATACCAAACGCCTTTATTCGTTTGGGCCGTCCTGATCACTGCCGTCCTCCTTCTTCTGTCGCTTCCAGTCCTTGCCGCCGGTATTACAATGCTACTGACGGACCGAAACCTGAATACAACCTTCTTCGACCCAGCAGGCGGAGGGGATCCTATCCTCTACCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Parupeneus barberinoides

Parupeneus barberinoides, the bicolor goatfish, is a species of goatfish native to the western Pacific Ocean. An inhabitant of coral reefs, it can be found at depths of from 1 to 40 metres (3.3 to 131.2 ft). This species can reach a length of 30 centimetres (12 in) TL though most are only around 20 centimetres (7.9 in). This is a commercially important species and can also be found in the aquarium trade.[1]

References[edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Parupeneus barberinoides" in FishBase. December 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!