Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Syngnathoides biaculeatus, the Alligator Pipefish, is a member of the family Syngnathidae (along with the pipefishes, this family includes the seahorses and sea dragons). Alligator Pipefish are found in shallow coastal waters, living among seagrasses, where they feed on small crustaceans and fish (Nakamura et al. 2003). Alligator Pipefish grow to around 280 mm total length. The Alligator Pipefish is thought to be the most heavily exploited pipefish in traditional Chinese medicine. (Barrows et al. 2008 and references therein)

As is the case for the males of all pipefishes and seahorses, male Alligator Pipefish incubate the eggs before they hatch. Eggs are protected in male brood pouches until they have fully developed and hatch as juveniles. In this species, males have a simple "pouch" morphology in which the embryos are attached to the ventral surface of the male abdomen, which has no flaps of surrounding tissue. Initial clutch size is directly correlated to the size of the male carrying the eggs. Reproduction occurs year-round and generation time is short. (Barrows et al. 2008 and references therein).

The Alligator Pipefish has a wide geographic range, being found in seagrass habitats from the northern Red Sea and the eastern coast of Africa eastward to Japan, Samoa, the Tonga Islands, and Australasia (Dawson 1985, cited in Barrows et al. 2008).

  • Barrows, A. P., Martin-Smith, K. M., and M.S. Baine. 2009. Population variables and life-history characteristics of the alligator pipefish, Syngnathoides biaculeatus in Papua New Guinea. Journal of Fish Biology 74: 806-819.
  • Nakamura, Y., Horinouchi, M., Nakai T., and M. Sano. 2003. Food habits of fishes in a seagrass bed on a fringing coral reef at Iriomote Island, southern Japan. Ichthyological Research 50:15-22.
  • Additional information and references can be found on the IUCN Red List page for this species.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sara Eckert and Leo Shapiro

Supplier: Sara Eckert

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Occur in protected coastal shallows over or among algae, seagrasses (Ref. 41878), or floating weeds (Ref. 1602). Juveniles occasionally found near the surface (Ref. 4281). Ovoviviparous (Ref. 205). The males carry the eggs in a brood pouch which is found under the tail (Ref. 205). Used in Chinese medicine to extract Hailong, one of the important drugs (Ref. 12206). Has been reared in captivity (Ref. 35416).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Syngnathoides biaculeatus has a wide geographic range. It has been recorded in surveys and taxonomic overviews from the Red Sea and the African east coast to Knysna, South Africa (Dawson 1985, Dawson 1986). It is also found in the Indo-Pacific from the east coast of India, throughout the South China Sea and has been recorded as far northward as northern Japan. It has been found in three states and one territory in Australia: Western Australia, the Northern Territory, Queensland, and New South Wales (Paxton et al. 1989). It has been recorded near the islands of Micronesia and Samoa (Randall et al. 1997).

Australian Marine Protected Areas in Which Has Been Recorded (Pogonoski et al. 2002): In Australia, S. biaculeatus is found in the following marine protected areas: Ashmore Reef National Nature Reserve, off northern Western Australia, Cartier Island Marine Protected Area, Great Barrier Reef Marine Park, Queensland, and CoburgMarinePark, in the Northern Territory (Pogonoski et al. 2002).

Museum Records Worldwide: in Australia, there are 106 specimens (standard length 100-288 mm), collected from a depth range of 0 to 5 m, ranging in geographical distribution from the Timor Sea, Northern Territory south-eastwards to Batemans Bay (35°44’S), New South Wales on the east coast of Australia, and from Ashmore Reef (12°13’S) southwards to Geraldton (28°46’S) on the west coast of Australia. Outside Australia there are specimens from the Andaman Islands, India, Malay Archipelago, Guam, Papua New Guinea and the Solomon Islands. Specimens were collected between circa 1879 and 1998 (Pogonoski et al. 2002).

Other museum records are available from FishBase and the Ocean Biogeographic Information System (OBIS) and include specimens collected from Suva Harbor in Fiji, Singapore, Kenya, and Yemen (Froese and Pauly 2007, Ocean Biogeographic Information System 2007). Specimens listed in Fishbase/OBIS have collection dates from 1828 to 2004.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Red Sea and Knysna, South Africa (Ref. 4281) to Samoa, north to southern Japan, south to New South Wales.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Madagascar and Mauritius (Mascarenes) east to Marshall Islands and Samoa, north to southern Japan, south to Western Australia, New South Wales (Australia), New Caledonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 38 - 48; Analspines: 0; Analsoft rays: 4
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 290 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

29.0 cm TL (male/unsexed; (Ref. 4281))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Occurs in protected coastal shallows over or among algae, seagrasses, or floating weeds (Ref. 1602). Juveniles occasionally found near the surface (Ref. 4281).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Variable green to brown or grey, depending on habitat (Ref. 48635).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

Habitat

Syngnathoides biaculeatus is generally found in seagrass beds or algal flats in the protected shallow waters of lagoons and bays, its colouring matching plants well (Randall et al. 1997). Adults are found in large Sargassum rafts (Kuiter 1996) and juveniles are occasionally found among debris floating offshore (Dawson 1985). In Queensland, Australia, this species is found in estuaries, usually in association with Zostera seagrass, to which it anchors itself by means of its prehensile tail (Grant 1978).

Behaviour and Biology

Syngnathoides biaculeatus has a breeding season of between October and April in Moreton Bay, Australia (Takahashi et al. 2003) but year-round in BootlessBay, PNG (Barrows et al. unpub). Males mature and can begin brooding at a length of about 180 mm (Dawson, 1985; Takahashi et al. 2003) although smaller mature males have been observed (Barrows et al., unpub). Brood size for males was comparable to that of other syngnathids, at 60-200 eggs (Takahashi et al. 2003) although ongoing research suggests that larger broods can occur (Barrows et al., unpub). The eggs can vary in colour (they can be clear, white, brown, or green) as they develop and are carried on the abdomen of the male until they hatch (Grant 1978, Takahashi 2000).

Syngnathoides biaculeatus is a poor swimmer, propelling itself by the winnowing action of the dorsal and pectoral fins (Pogonoski et al. 2002). Some individuals have been observed near the surface of the water or jumping out of the water entirely (Dawson 1986, Kuiter 1996). Prey items include shrimps, fish, and amphipods (Nakamura et al. 2003) as well as other tiny crustaceans (Allen and Swainston 1992).

Size

Syngnathoides biaculeatus has been reported to achieve a maximum length of between 260 to 300 mm (Kuiter 1996, Takahashi et al. 2003) and displays significant size dimorphism, with males growing bigger than females (Takahashi et al. 2003). Although growth of S. biaculeatus has been reported as rapid over a life span of less than two years (Takahashi et al. 2003), more recent studies suggest that growth rates are slower and life spans can reach three years (Barrows et al. unpub data).


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 15 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 0.915 - 475
  Temperature range (°C): 28.408 - 28.954
  Nitrate (umol/L): 0.050 - 0.617
  Salinity (PPS): 33.821 - 34.438
  Oxygen (ml/l): 4.450 - 4.545
  Phosphate (umol/l): 0.072 - 0.160
  Silicate (umol/l): 1.103 - 1.900

Graphical representation

Depth range (m): 0.915 - 475

Temperature range (°C): 28.408 - 28.954

Nitrate (umol/L): 0.050 - 0.617

Salinity (PPS): 33.821 - 34.438

Oxygen (ml/l): 4.450 - 4.545

Phosphate (umol/l): 0.072 - 0.160

Silicate (umol/l): 1.103 - 1.900
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occur in protected coastal shallows over or among algae, seagrasses, or floating weeds (Ref. 1602). Juveniles occasionally found near the surface (Ref. 4281). Feed on benthic invertebrates and zooplankton (Ref. 11889).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Male carries the eggs in a brood pouch (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Syngnathoides biaculeatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTTGGTGCATGAGCTGGAATAGTCGGGACCGCCCTAAGCCTACTTATCCGAGCAGAGCTAAGCCAACCCGGGGCCCTACTAGGGGATGATCAGATTTATAATGTAATTGTCACCGCCCATGCATTCGTCATAATTTTCTTTATAGTTATACCAATCATGATTGGCGGCTTTGGTAATTGGTTAGTTCCACTAATAATTGGGGCACCCGATATAGCCTTTCCCCGAATAAACAATATAAGCTTCTGGCTTCTTCCGCCCTCTTTTCTTCTTCTCCTTGCCTCATCTGGGGNTGAAGCAGGAGCAGGCACCGGATGAACTGTTTATCCACCCCTTGCAGGTAACCTCGCCCATGCAGGAGCATCAGTAGACCTTACTATTTTCTCCCTTCACTTAGCAGGAGTTTCCTCAATCCTAGGGGCAATTAACTTCATCACCACTATTATTAACATAAAACCACCCTCTATTTCCCAATACCAAACACCCTTGTTCGTCTGAGCCGTCCTAATTACTGCTGTCCTCCTTCTATTGTCACTCCCAGTTTTGGCAGCCGGCATTACAATACTCCTCACAGACCGCAACCTTAATACAACCTTTTTTGACCCTGCCGGAGGGGGTGACCCAATTCTTTACCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Syngnathoides biaculeatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Bartnik, S., Morgan, Pogonoski, J., Pollard, D. & Paxton, J.

Reviewer/s
Martin-Smith, K. & Caldwell, I. (Syngnathid Red List Authority)

Contributor/s

Justification
This species meets the criteria for a Data Deficient listing. The information available for Syngnathoides biaculeatus includes distribution and life history parameters such as growth, reproduction, and development data (Takahashi et al. 2003, Dhanya et al. 2005) but excludes data on population dynamics. Syngnathoides biaculeatus is a syngnathid that has a long history of use in traditional medicine (Shi et al. 1993, Pogonoski et al. 2002). While there is abundant information on the occurrence of this species, information on catch and trade levels is scarce. A listing of Data Deficient does not imply that the taxon is not threatened but that not enough information exists to quantify or even estimate extinction risk. Application of the category Data Deficient is a call for more research and scrutiny to be directed at this species. Until there exists more information on the main exploitation method for S. biaculeatus, (as it is not known if there are directed fisheries for the species or if individuals are caught only as bycatch), the distribution of any fisheries, and the volume of individuals that are caught and traded, the impact of the trade for traditional medicines cannot be assessed with rigour.

History
  • 1996
    Data Deficient
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

While S. biaculeatus has been reported by many authors in its range, there is no information available to our knowledge about population structure or sizes. Takahashi et al. (2003) (and earlier thesis Takahashi 2000) report on index of population size (CPUE) and seasonal changes in Moreton Bay, Queensland. Work in Bootless Bay, PNG (Barrows, Baine and Martin-Smith unpub. data) shows they are very common (found at all seagrass sites) in moderate abundance (2-6 individuals/100 m²) with no systematic changes across the year.


Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

This species has a history of use in the Chinese traditional medicine trade. Known as Hailong (Shi et al. 1993), it has been observed for sale in traditional medicine stores in Sydney, Australia (C. Woodfield, pers. comm., Martin-Smith and Vincent 2006). The origins of the specimens that enter the medicine trade have not been established, although it is likely there are from wild populations as S. biaculeatus rearing in aquaculture facilities has not been reported. Live specimens are also sold as pets for home aquariums and this trade could threaten wild populations if individuals are being removed from the wild to fulfill the home aquarium industry demand (S. Bartnik, pers. obs).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species has been identified or protected by the following conservation actions.
  • In Australia all syngnathids became subject to the export controls of the Commonwealth Wildlife Protection (Regulation of Exports and Imports) Act 1982 on 1 January 1998 (Pogonoski et al. 2002).
  • In Australia, all syngnathids and solenostomids are listed as marine species under section 248 of the Environment Protection and Biodiversity Conservation (EPBC) Act 1999 (Pogonoski et al. 2002).
  • This species is listed as Data Deficient by the Australian Society for Fish Biology (ASFB) in its 2001 Conservation Status of Australian Fishes document, the most recent AFSB listing available (ASFB 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Alligator pipefish

The alligator pipefish or double-ended pipefish (Syngnathoides biaculeatus) is a species of fish in the Syngnathidae family. The green-yellowish body can reach 25 cm. It live in habitats of seagrass and weed, and hides by diving down vertically to blend in with the light green seagrass. It sucks up prey and zooplankton, while it has no teeth.

It is found in Australia, Egypt, Fiji, India, Indonesia, Japan, Madagascar, Marshall Islands, Micronesia, Mozambique, Northern Mariana Islands, Papua New Guinea, the Philippines, Samoa, the Solomon Islands, South Africa, Brazil, Sri Lanka, Taiwan, and Tonga.

Source[edit source | edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!