Overview

Comprehensive Description

Biology

Adults inhabit coral and rocky reefs (Ref. 9334). Feed mainly on plankton (Ref. 9334). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: chromis (English), damselfish (English), castañeta (Espanol), castañuela (Espanol), damisela (Espanol)
 
Chromis alta Greenfield & Woods, 1980


Silverstripe chromis,     Oval chromis,     Oval damselfish



Body compressed, deep, oval, greatest body depth 1.8-2.2 in SL; 1 pair of nostrils; edge of bone under eye smooth; preopercle smooth or with occasional fine serrations; mouth small, protrusible, opens at front;  teeth in 2 rows, outer conical, larger; gill rakers 27-33; a single continuous dorsal fin, XIII, 12-14; anal rays II,12-13; pectoral rays 19-21; 2-3 short projecting spines at upper and lower base of tail fin; caudal fin forked; scales large and rough; 16-19 lateral line scales; body scaled,  most of head scaled, basal parts of the median fins scaled; lateral line incomplete, ends under end of dorsal fin base.

Light brown with darker scale margins; juveniles  blue with neon-blue stripe above and below eye, and broad whitish band along base of dorsal fin that joins diffuse pale bar across tail base.


Maximum size to 15 cm.

Inhabits rocky reefs.

Depth: usually in about 1-200 m depth, but shallow in the Galapagos (5-45 m).



Southern California to the lower Gulf of California, all the offshore islands, and Lobos de Afuera islands off Peru.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Eastern Pacific: Mexico and the Galapagos Islands. One record from Cocos Island.
  • Schneider, W. and F. Krupp 1995 Pomacentridae. Castañetas, jaquetas y petacas. p. 1392-1404. In W. Fischer, F. Krupp, W. Schneider, C. Sommer, K.E. Carpenter and V. Niem (eds.) Guia FAO para Identification de Especies para lo Fines de la Pesca. Pacifico Centro-Oriental. 3 Vols. FAO, Rome. (Ref. 9334)   http://www.fishbase.org/references/FBRefSummary.php?id=9334&speccode=11853 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is endemic to the Eastern Pacific, and is found from southern California and the western and southeastern Gulf of California to southern Mexico, all the offshore islands, and in the Lobos de Afuera islands off Peru.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 200 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, East Pacific endemic, Tropical Eastern Pacific (TEP) endemic

Regional Endemism: All species, TEP endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 12 - 14; Analspines: 2; Analsoft rays: 12 - 13
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 15.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 130 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

13.0 cm SL (male/unsexed; (Ref. 7247))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Chromis alta Greenfield & Woods
Catalog Number: USNM 219028
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Radiograph
Collector(s): H. Fehlmann
Year Collected: 1966
Locality: Galapagos Islands: Isla Isabela (Albemarle Island) Rocky Area About 1 mi. N. of Caleta At Pta. Tortuga, Albemarle Island (Isabela), Galapagos Islands, Pacific
Depth (m): 15
Vessel: Anton Bruun
  • Paratype: Greenfield, D. W. & Woods, L. P. 1980. Copeia. 1980 (4): 630.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 30 - 150 m (Ref. 9334)
  • Schneider, W. and F. Krupp 1995 Pomacentridae. Castañetas, jaquetas y petacas. p. 1392-1404. In W. Fischer, F. Krupp, W. Schneider, C. Sommer, K.E. Carpenter and V. Niem (eds.) Guia FAO para Identification de Especies para lo Fines de la Pesca. Pacifico Centro-Oriental. 3 Vols. FAO, Rome. (Ref. 9334)   http://www.fishbase.org/references/FBRefSummary.php?id=9334&speccode=11853 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species inhabits deep rocky reefs (Allen, 1991) and coral reefs to depths of 200m.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 15 - 122
  Temperature range (°C): 14.586 - 14.586
  Nitrate (umol/L): 22.401 - 22.401
  Salinity (PPS): 34.980 - 34.980
  Oxygen (ml/l): 2.139 - 2.139
  Phosphate (umol/l): 1.809 - 1.809
  Silicate (umol/l): 18.397 - 18.397

Graphical representation

Depth range (m): 15 - 122
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 30 - 150m.
From 30 to 150 meters.

Habitat: reef-associated. Lives in inshore and offshore coral and rocky reefs. Feeds on plankton (Ref. 9334).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Near Bottom, Bottom, Bottom + water column

Habitat: Reef (rock &/or coral), Reef only, Rocks, Corals, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Planktivore

Diet: Pelagic crustacea, zooplankton, pelagic fish eggs
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Egg Type: Benthic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chromis alta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCTTGAGCTGGAATAGTAGGCACAGCTTTGAGCCTCCTCATTCGAGCAGAACTGAGCCAACCAGGCGCTCTCCTCGGAGACGACCAAATTTACAATGTTATCGTTACGGCACACGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGGTTTGGAAACTGACTTATTCCCCTCATGATTGGAGCCCCCGATATGGCATTTCCCCGAATAAATAACATAAGCTTCTGACTCTTGCCCCCCTCATTCCTACTTCTGCTTGCCTCCTCTGGTGTTGAAGCAGGTGCAGGCACAGGATGAACTGTATACCCCCCTCTATCAGGAAATCTAGCACACGCGGGAGCCTCCGTAGACTTAACCATTTTCTCCCTCCACTTAGCAGGTATTTCCTCAATCCTAGGGGCCATTAACTTCATTACTACCATCATTAATATGAAACCCCCTGCCATTTCCCAATATCAGACCCCTCTGTTTGTTTGAGCTGTACTCATCACCGCTGTACTCCTCCTCTTATCCCTTCCAGTCTTAGCTGCTGGCATTACCATGCTTTTAACCGATCGTAACCTAAACACCACGTTCTTCGACCCTGCAGGAGGAGGAGACCCAATCCTTTACCAGCATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chromis alta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Allen, G., Robertson, R., Edgar, G., Bessudo, S., Zapata, F., Rivera, F., Merlen, G.

Reviewer/s
Carpenter, K., Polidoro, B., Livingstone, S. (Global Marine Species Assessment Team)

Justification
This species is widespread in the Eastern Pacific, and is common in many parts of its range. There are no major threats for this species, and no current indication of population decline. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is considered common in some parts of its range, especially in deep reefs in Malpelo, Clipperton and Revillagigedo Islands.

This species was studied in different sites at Galapagos archipelago, with an overall mean abundance of 1.49 ind./500 m2 (Edgar et al. 2004). In Cabo Pulmo, Mexico, this fish was considered scarce with 0.1-1% of the overall abundance registered and a relative frequency below 10% (Villarreal-Cavazos et al. 2000).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are no major threats known for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation measures for this species. However, this species distribution falls partially into a number of Marine Protected Areas in the Eastern Pacific region (WDPA 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!