Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Sold fresh.
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Epinephelus amblycephalus is a western Pacific species distributed from the Andaman Sea to southern Japan, Taiwan, China, Philippines, Viet Nam, Malaysia, Thailand, Indonesia, New Guinea, the Arafura Sea, north-western Australia, and Fiji (Heemstra and Randall 1993).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Pacific: Andaman Sea to southern Japan, Taiwan, China, Philippines, Viet Nam, Malaysia, Thailand, Indonesia, New Guinea, the Arafura Sea (Ref. 9819), northwestern Australia, and Fiji.
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Indian Ocean and Western Pacific: Andaman Sea east to Fiji, north to southern Japan, south to northwestern Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 15 - 16; Analspines: 3; Analsoft rays: 8
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

50.0 cm TL (male/unsexed; (Ref. 5222))
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Epinephelus amblycephalus occurs on coral and rocky reefs in depths of 80 to 130 m (Heemstra and Randall 1993). Tseng and Chan (1985) discussed food, rearing procedures and larval development E. amblycephalus from Hong Kong.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 80 - 130 m (Ref. 5222)
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 54 specimens in 1 taxon.
Water temperature and chemistry ranges based on 36 samples.

Environmental ranges
  Depth range (m): 24 - 175
  Temperature range (°C): 16.430 - 26.503
  Nitrate (umol/L): 0.164 - 17.826
  Salinity (PPS): 34.614 - 35.100
  Oxygen (ml/l): 2.536 - 4.701
  Phosphate (umol/l): 0.175 - 1.399
  Silicate (umol/l): 3.468 - 27.099

Graphical representation

Depth range (m): 24 - 175

Temperature range (°C): 16.430 - 26.503

Nitrate (umol/L): 0.164 - 17.826

Salinity (PPS): 34.614 - 35.100

Oxygen (ml/l): 2.536 - 4.701

Phosphate (umol/l): 0.175 - 1.399

Silicate (umol/l): 3.468 - 27.099
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 80 - 130m.
From 80 to 130 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits coral reefs (Ref. 58534).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Epinephelus amblycephalus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 43
Specimens with Barcodes: 50
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Epinephelus amblycephalus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 29 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTTGTATTTGGTGCCTGAGCCGGTATAGTAGGAACCGCCCTCAGCCTTCTTATTCGGGCTGAACTAAGCCAACCTGGGGCCCTACTCGGCGATGATCAAATCTACAATGTAATTGTTACAGCACATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGTGGCTTTGGAAACTGACTTATTCCACTTATAATTGGCGCCCCAGACATAGCATTCCCTCGAATGAATAACATAAGCTTCTGACTCCTTCCCCCATCTTTCCTGCTTCTTCTAGCCTCTTCTGGAGTAGAAGCCGGTGCTGGTACTGGTTGAACAGTTTATCCACCCCTGGCGGGAAACCTAGCACATGCAGGTGCATCCGTAGACCTAACCATCTTCTCCCTGCATTTAGCAGGAATTTCATCAATTCTAGGGGCAATTAACTTCATTACAACTATTATTAACATAAAACCCCCCGCCACTTCCCAGTATCAAACACCTTTGTTTGTGTGAGCTGTTCTAATTACAGCAGTGCTACTGCTCCTATCACTCCCCGTTCTTGCCGCAGGTATTACAATACTTCTAACGGATCGTAACCTTAACACTACTTTCTTTGACCCGGCCGGAGGAGGAGACCCTATCCTCTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Russell, B. & Myers, R.

Reviewer/s
Sadovy, Y. & Moss, K. (Grouper and Wrasse Red List Authority)

Contributor/s

Justification
Epinephelus amblycephalus is listed as Data Deficient since there is very little known about current harvest levels and there are questions about its distribution. A re-assessment of this species is warranted as more information becomes available.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There are no population data for Epinephelus amblycephalus.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Overfishing is the greatest threat to Epinephelus amblycephalus. E. amblycephalus is a popular and commercially important species in Hong Kong (Tseng and Chan 1985), but in Singapore is “Not a popular grouper in the market” (Tan et al. 1982). The species is presently rarely observed in Hong Kong markets (Min pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There is no known conservation measures for Epinephelus amblycephalus.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: very high; price reliability: questionable: based on ex-vessel price for species in this genus
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!