Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits clear, shallow waters of outer reef areas. Also found in lagoons, back-reef areas, and on the reef-top. Feeds on small fishes (68%) and crustaceans.
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

General
Cephalopholis urodeta is widely distributed within the Pacific Ocean, occurring eastward to French Polynesia and the Pitcairn Islands, and on Christmas Island in the Indian Ocean.

Recent records
There are recent new records of darkfin hind from Howland Island, Baker Island, Jarvis Island, Palmyra Atoll, and Kingman Reef (B. Mundy pers. comm.) and from Brunei (A. Conish, pers. comm.).

Introductions
C. urodeta was introduced into Hawaii in 1958-1961, but it did not become established there (Randall 1987).

Specific localities
Calamianes Islands; Davao Gulf; Coral Sea; Great Barrier Reef; Hsiao-liu-chiu; Indonesian Sea; Kimbe Bay; Kuroshio current; Lagonoy Gulf; Lingyen Gulf, Milne Bay; north northeast and northwest Australian Shelves; Panay Gulf; Peng-hu; Polynesian waters; Ragay Gulf; South China Sea; Spratly Islands; Sulu-Celebes Sea; Tubbataha Reefs; and Verde Island Passage.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East Africa, Madagascar and Mascarenes east to Wake Atoll, Line Islands and Pitcairn Group, south to Western Australia at 32°01'S, Queensland (Australia) at 18°16'S, New Caledonia, Tonga and Rapa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Kenya to northern South Africa and eastward to French Polynesia and the Pitcairn Islands. Unknown from the Red Sea, Gulf of Aden, Gulf of Oman, Persian Gulf, and the coast of India.
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 14 - 16; Analspines: 3; Analsoft rays: 8 - 9
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 280 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

28.0 cm TL (male/unsexed; (Ref. 5222))
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits clear, shallow waters of outer reef areas, also found in lagoons, back-reef areas, and on the reef-top. Feeds on small fishes (68%) and crustaceans.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
General
Cephaplopholis urodeta is a reef-associated species that is not tolerant of habitat degradation. The species prefers clear, shallow waters of outer reef areas to 60 m. It is occasionally found in lagoons, back-reef areas, and on the reef-top.

Country-specific
In Iriomote Island, Ryukyu Islands, Japan, it occurs on reef flats and slopes (Nakai et al. 2001). In Rota, Mariana Islands, it occurs largely on the upper reef terrace at 2 to 13 m, and is associated with coral pavement (Donaldson 2002). In Iriomote Island, Ryukyu Islands, Japan, C. urodeta is one of the dominant groupers (together with Epinephelus merra and E. fasciatus) (Nakai et al. 2001).

Feeding
Darfkfin hind feed mainly on small fishes and crustaceans. In a quantitative study of the stomach content in Iriomote Island, Ryukyu Islands, Japan (Nakai et al. 2001), small fish and decapod crustaceans constituted 73.4% of stomach contents by weight. Diet composition has seasonal differences; diet is abundant from May to November, and higher hermit crabs in February.

Reproduction and maturity
The minimum size for sexual maturity is 17 cm TL, with a maximum size of 28 cm TL.

The reproductive biology of darkfin hind has been studied briefly (Nakai and Sano 2002). In Iriomote Island, Ryukyu Islands, Japan, darkfin hind ranged from 11.5 to 21.1 cm TL. Males were larger than females. Protogynous hermaphroditism was proposed, but unconfirmed, because the sexual transitional individuals (with degenerating mature oocytes) were not found in samples.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 60m.
From 1 to 60 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 60 m (Ref. 5222), usually 3 - 15 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 165 specimens in 1 taxon.
Water temperature and chemistry ranges based on 130 samples.

Environmental ranges
  Depth range (m): 0.5 - 59
  Temperature range (°C): 25.075 - 29.282
  Nitrate (umol/L): 0.019 - 1.251
  Salinity (PPS): 33.507 - 37.566
  Oxygen (ml/l): 4.314 - 4.806
  Phosphate (umol/l): 0.057 - 0.301
  Silicate (umol/l): 0.722 - 4.989

Graphical representation

Depth range (m): 0.5 - 59

Temperature range (°C): 25.075 - 29.282

Nitrate (umol/L): 0.019 - 1.251

Salinity (PPS): 33.507 - 37.566

Oxygen (ml/l): 4.314 - 4.806

Phosphate (umol/l): 0.057 - 0.301

Silicate (umol/l): 0.722 - 4.989
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits clear, shallow waters of outer reef areas. Also found in lagoons, back-reef areas, and on the reef-top. Feeds on small fishes (68%) and crustaceans (Ref. 5222).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Cephalopholis urodeta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 43
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Cephalopholis urodeta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATCTAGTATTTGGTGCCTGAGCCGGTATAGTAGGAACAGCTCTCAGCCTATTAATCCGGGCTGAGCTAAGCCAACCAGGTGCTTTACTCGGCGATGATCAAATCTACAATGTAATTGTTACGGCACATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGGTTCGGAAACTGACTTATCCCATTAATAATCGGTGCTCCCGATATGGCATTCCCCCGAATGAATAATATGAGCTTTTGACTCCTCCCCCCATCCTTCCTACTTCTGCTAGCCTCCTCTGGAGTAGAAGCTGGTGCTGGTACTGGCTGAACAGTGTATCCACCTTTAGCCGGTAACCTAGCCCATGCAGGTGCCTCCGTTGATCTAACTATCTTTTCCCTACATTTAGCAGGTATCTCATCAATTTTAGGGGCTATTAACTTTATTACTACTATTATTAACATAAAACCACCTGCCATCTCTCAATACCAAACACCCTTATTTGTTTGAGCTGTACTCATCACAGCCGTCCTTCTTCTACTTTCCCTTCCTGTCCTTGCCGCCGGTATTACAATACTCCTAACAGATCGAAATCTTAACACCACCTTCTTCGATCCTGCTGGCGGAGGAGACCCAATCCTTTACCAACATCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Western Australian Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Liu, M., Yeeting, B., Russell, B., Craig, M.T., Heemstra, P.C. & Pollard, D.

Reviewer/s
Sadovy, Y. & Moss, K. (Grouper and Wrasse Red List Authority)

Contributor/s

Justification
Cephelopholis urodeta is listed as Least Concern because it is a widespread and not known to be in serious decline at present; however, it is sensitive to habitat degradation and may become threatened in the future.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
General
Cephalopholis urodeta is a very common species throughout its range and is not known or suspected to be in decline.

Hybridization
Hybridizes with C. nigripinnis at Christmas Island (Randall and Heemstra 1991).

Reproduction
In the Mariana Islands, C. urodeta appeared to have a mating group organization with a single male and six to eight females (Donaldson 1995).

Fisheries-independent data
In Brunei, a UVC survey in 2004 showed low abundance and biomass (A. Cornish pers. comm.):
Abundance: 0/transect (5x50m); Biomass: 0.5g/transect).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
General
Major threats to darkfin hind are habitat destruction due to coral reef loss and degradation, climate change and in particular coral bleaching (present and future threat).

Fisheries
Darkfin hind are a target of the subsistence fishery in some regions. It is also targeted by the aquarium trade.

In Hong Kong, it is sold occasionally in markets (fishers caught locally by hook-and-line and traps), with price HK$26-30/pound and size mainly 15 to 20 cm TL (Min Liu unpub. data).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Darkfin Hind are present within numerous protected area throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; aquarium: potential
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cephalopholis urodeta

Cephalopholis urodeta, known commonly as the Flagtail Grouper or also V-tail Grouper, is a species of marine fish in the family Serranidae.

The Flagtail Grouper is widespread throughout the tropical waters of the Indo-Pacific area, Red Sea excluded.[2]

The V-tail Grouper is a medium size fish and can reach a maximum size of 28 cm length .[3]

References[edit]

  1. ^ Liu, M., Yeeting, B., Russell, B., Craig, M.T., Heemstra, P.C. & Pollard, D. 2008. Cephalopholis urodeta. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 09 September 2013.
  2. ^ http://eol.org/pages/994957/details#distribution
  3. ^ http://www.fishbase.org/summary/6456
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Cephalopholis urodelus

Cephalopholis urodelus is a grouper fish from the Indo-Pacific Ocean. It occasionally makes its way into the aquarium trade. It grows to a size of 28 cm (11 in) in length.

References [edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!