Overview

Comprehensive Description

Biology

Inhabits rivers, preferring fast flowing, cooler waters of the mountain runoffs. Adults occur solitarily or in pairs (Ref. 7335). Omnivorous, specialized in fresh vegetation (Ref. 30499).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Atlantic slope of Guatemala.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Central America: Atlantic slope, in the Polochic River basin, Guatemala.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Max. size

30.0 cm TL (male/unsexed; (Ref. 36377))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; freshwater; pH range: 7.5; dH range: 10 - 20
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Vieja godmanni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Vieja godmanni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Theraps godmanni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTAGTTTTTGGTGCCTGAGCCGGAATAGTAGGAACCGCATTAAGCCTATTGATCCGAGCAGAACTCAGCCAACCAGGCTCTCTCCTTGGAGATGACCAGATTTATAATGTAATCGTAACTGCACACGCCTTTGTAATAATTTTCTTTATAGTCATACCTATCATAATTGGAGGTTTCGGCAACTGACTGATCCCACTCATGATCGGTGCCCCAGACATGGCCTTCCCTCGAATAAACAACATGAGCTTCTGACTTCTGCCCCCTTCGTTCCTCCTCCTCCTTGCTTCGTCAGGAGTTGAAGCTGGTGCCGGAACAGGCTGAACTGTCTACCCCCCGCTAGCAGGTAACCTGGCGCACGCTGGCCCCTCAGTCGACCTAACCATTTTCTCTCTCCATTTAGCGGGAGTCTCGTCTATCCTTGGGGCAATTAACTTTATTACCACAATTATTAACATGAAACCCCCAGCAATCTCCCAATACCAAACCCCCCTGTTTGTTTGAGCACTTCTAATTACCGCCGTCCTACTCCTGCTATCCCTGCCAGTCCTTGCCGCCGGCATCACTATACTTTTAACCGACCGAAACCTAAATACAACCTTTTTTGACCCGGCAGGAGGAGGGGACCCCATTCTCTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Theraps godmanni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!