Overview

Comprehensive Description

Biology

Inhabits rivers, preferring fast flowing, cooler waters of the mountain runoffs. Adults occur solitarily or in pairs (Ref. 7335). Omnivorous, specialized in fresh vegetation (Ref. 30499).
  • Conkel, D. 1993 Cichlids of North and Central America. T.F.H. Publications, Inc., USA. (Ref. 7335)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Atlantic slope of Guatemala.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Central America: Atlantic slope, in the Polochic River basin, Guatemala.
  • Kullander, S.O. 2003 Cichlidae (Cichlids). p. 605-654. In R.E. Reis, S.O. Kullander and C.J. Ferraris, Jr. (eds.) Checklist of the Freshwater Fishes of South and Central America. Porto Alegre: EDIPUCRS, Brasil. (Ref. 36377)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Max. size

30.0 cm TL (male/unsexed; (Ref. 36377))
  • Kullander, S.O. 2003 Cichlidae (Cichlids). p. 605-654. In R.E. Reis, S.O. Kullander and C.J. Ferraris, Jr. (eds.) Checklist of the Freshwater Fishes of South and Central America. Porto Alegre: EDIPUCRS, Brasil. (Ref. 36377)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; freshwater; pH range: 7.5; dH range: 10 - 20
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Vieja godmanni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Vieja godmanni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Theraps godmanni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTAGTTTTTGGTGCCTGAGCCGGAATAGTAGGAACCGCATTAAGCCTATTGATCCGAGCAGAACTCAGCCAACCAGGCTCTCTCCTTGGAGATGACCAGATTTATAATGTAATCGTAACTGCACACGCCTTTGTAATAATTTTCTTTATAGTCATACCTATCATAATTGGAGGTTTCGGCAACTGACTGATCCCACTCATGATCGGTGCCCCAGACATGGCCTTCCCTCGAATAAACAACATGAGCTTCTGACTTCTGCCCCCTTCGTTCCTCCTCCTCCTTGCTTCGTCAGGAGTTGAAGCTGGTGCCGGAACAGGCTGAACTGTCTACCCCCCGCTAGCAGGTAACCTGGCGCACGCTGGCCCCTCAGTCGACCTAACCATTTTCTCTCTCCATTTAGCGGGAGTCTCGTCTATCCTTGGGGCAATTAACTTTATTACCACAATTATTAACATGAAACCCCCAGCAATCTCCCAATACCAAACCCCCCTGTTTGTTTGAGCACTTCTAATTACCGCCGTCCTACTCCTGCTATCCCTGCCAGTCCTTGCCGCCGGCATCACTATACTTTTAACCGACCGAAACCTAAATACAACCTTTTTTGACCCGGCAGGAGGAGGGGACCCCATTCTCTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Theraps godmanni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!