Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Biology

The sluggish spotted wobbegong spends much of its day lying motionless on the bottom or hidden in caves, under overhangs or in shipwrecks. At night, the shark becomes more active, and swims, or moves about the sea floor, searching for prey to slowly sneak up on (2). Bottom-dwelling animals such as reef fishes, octopuses, crabs and rock lobsters are some of their preferred foods (4), many of which blunder unwittingly towards the mouth of the camouflaged wobbegong. By opening its wide mouth and expanding its throat, the wobbegong can effectively suck in its prey, trapping and killing it with its powerful jaws and big teeth. After a night spent hunting, the spotted wobbegong, which is observed singly or in aggregations, often returns to the same resting site (2). The nocturnal spotted wobbegong is an ovoviviparous shark, thus the embryos develop inside eggs that remain inside the mother until they hatch. Females give birth to large litters, usually of around 20 pups, but up to 37 pups have been recorded (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

With its broad and flattened body, and cryptic colouration, the spotted wobbegong is perfectly adapted to a life on the seabed. It has yellowish-green or brown skin on its back, patterned with white 'O' shaped markings and dark blotches, and darker saddle-stripes. Fleshy projections (nasal barbels) used to taste and feel, hang down by the nostrils, and six to ten dermal lobes, or tassels of skin, hang below and in front of the eyes on each side of head (2) (3). Despite its unthreatening appearance, the spotted wobbegong is capable of inflicting powerful bites if provoked (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Found on the continental shelf, from the intertidal down to at least 110 m (Ref. 247). Commonly on coral and rocky reefs, under piers, and on sand bottom (Ref. 247). May occur in water barely deep enough to cover the fish, and has been observed climbing ridges between tide pools with its back out of water (Ref. 247). Nocturnal (Ref. 247). Feeds on bottom invertebrates (Ref. 247), including crabs, lobsters and octopuses (Ref. 43278), and bony fishes (Ref. 247), like sea bass, scorpionfishes and luderick (Ref. 43278). Ovoviviparous (Ref. 43278, 50449), with up to 37 pups in a litter (Ref. 247). Known to bite people that step on it or put their feet near its mouth, and can and will bite when molested and provoked (Ref. 247). Flesh highly regarded and sometimes utilized for human consumption (Ref. 247). Skin sometimes utilized for leather (Ref. 247). Regarded as pest by lobster fishers (Ref. 247).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Orectolobus maculatus is most likely an Australian endemic wobbegong.

Orectolobus maculatus has been recorded from tropical eastern Australia with confirmed reports from Gladstone (22°S), Queensland (Kyne et al. 2005) southwards to Hobsons Bay (37°52'S), Victoria, westwards to St. Vincents Gulf (35°10'S, 137°55'E), South Australia, and north-westwards to Bessieres Island (21°23?S, 114°41?E), Western Australia (J. Chidlow unpub. data). Tasmanian records are probably invalid (Last and Stevens 1994).

Previous sources (Last and Stevens 1994, Compagno 2001) show that the global distribution of O. maculatus includes Japan and the South China Sea. However, wobbegongs from these areas could be different undescribed species of wobbegongs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Indian Ocean: southern Australia, from Western Australia to southern Queensland. Records from Japan and the South China Sea need to be confirmed.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Spotted wobbegong are generally found in inshore waters off the southern and southeastern coasts of Australia, from the Fremantle region in Western Australia to Moreton Island in southern Queensland (Pollard et al, 2003). Some sources indicate that spotted wobbegong have a global distribution that includes Japanese waters and the South China Sea (Eagle, 2005). However, the World Conservation Union states that these records are probably incorrect and are most likely the result of difficulty in distinguishing spotted wobbegong from other, closely related, species. If so, spotted wobbegong should be considered endemic only in the Australian regions described above (Pollard et al, 2003).

Biogeographic Regions: pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific, but possibly only Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Occurs in the western Pacific, off the south coast of Australia. There are also records from Japan and the South China Sea but these require confirmation (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

The average spotted wobbegong ranges in length between 150 and 180 centimeters (59-71 inches) in total length. Males usually mature at around 60 centimeters (24.6 inches). The largest recorded spotted wobbegong was measured at 360 centimeters (126 inches). At birth, the average newborn is 21 cm (8.3 inches) (Eagle. 2005).

Spotted wobbegongs belongs to the Order Orectolobiformes, commonly called carpet sharks because of their ruffled, rug-like appearance (Dewey et al., 2005). The coloration pattern of spotted wobbegongs provides camouflage against the varying color patterns of the environment it inhabits. They are generally a pale yellow or green-brown with large, dark areas down the midline of the body. White "O"-shaped spots often cover the entire back of the shark. Although other species of Orectolobidae family are usually similar in appearance, the coloration pattern of spotted wobbegong is distinctive (Eagle, 2005).

Besides the distinctive color pattern, spotted wobbegong are easily identified by their flattened heads, possessing six to ten dermal lobes below and in front of the eyes, and having long nasal barbels around the mouth and on the sides of head (“UN Atlas of the Oceans”, 2005). The barbels are sometimes branched basally. The mouth lies in front of the eyes with two rows of fang-like teeth in the upper jaw and three in the lower jaw. Spotted wobbegongs can also be characterized by their large spiracles, a lack of dermal tubercles or ridges on the back, a symphisial groove on the chin, and nasoral and circumnarial grooves. The dorsal fins are spineless and the first begins over the pelvic base with the anal fin originating behind the second dorsal fin. The pectoral and pelvic fins are large and broad, and the caudal fin is much shorter than the rest of the body (Compagno, 2002).

Range length: 60 to 320 cm.

Average length: 165 cm.

Average basal metabolic rate: unknown cm^3 oxygen/hour.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 3200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

320 cm TL (male/unsexed; (Ref. 247))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Back dark, with light O-shaped markings obscuring darker saddles (Ref. 13577). Caudal fin with its upper lobe hardly elevated above the body axis, with a strong terminal lobe and subterminal notch but no ventral lobe (Ref. 13577).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Compagno (2001) describes this species as ?an abundant, temperate to tropical, inshore to offshore bottom shark of the continental shelves of the western Pacific, commonly on coral and rocky reefs, in coastal bays, in estuaries, in seagrass beds, under piers, and on sandy bottoms.? Juveniles occur in estuaries and are occasionally found over seagrass beds. It can occur in water barely deep enough to cover it, and has been observed climbing ridges between tide pools with its back out of water (Compagno 2001). In a study in Port Stephens, NSW, a sympatric species of wobbegong (O. ornatus) was shown to prefer sponge gardens, artificial structures and barren boulders habitats with a high topographic complexity and crevice volume (Carraro and Gladsone 2006). However, O. ornatus did not seem to select habitat on the basis of prey availability and habitat selection may therefore be related to predator avoidance (Carraro and Gladsone 2006). Orectolobus maculatus occurs inshore on the continental shelf to at least 218 m depth (Kyne et al. 2005). It is often found in murkier water than the closely related O. Halei (Lieske and Myers 1994).

A survey on wobbegongs shows evidence of site-attachment with divers observing individual sharks in exactly the same positions over consecutive dives (The Ecology Lab 1991). Furthermore, a sympatric species of wobbegong (O. halei) has been recorded within the same area for over 2.5 years (Huveneers et al. 2006, Huveneers unpub. Data), and another sympatric species of wobbegong (O. ornatus) has been re-sighted within a 75 hectares area for a period of over 211 days suggesting site fidelity (Carraro and Gladstone 2006).

Compagno (2001) describes this shark as a nocturnal species that rests on the bottom during the day in caves, under ledges on reefs, and in trenches and that undertakes nocturnal excursions away from resting areas. As a primarily nocturnal feeder, it preys on bottom invertebrates and fishes (Last and Stevens 1994). Compagno (2001) cites the prey of O. maculatus as bony fishes, sharks, rays, cephalopods and crustaceans. A NSW study found elasmobranchs, osteichthyes (reef, benthic and a few pelagic fishes, and moray eels) and cephalopods as prey items (Huveneers et al. 2007a). No crustaceans were found in the stomachs of O. maculatus caught in the NSW. Sampled sharks were, however, mostly large juveniles and adults (>100 cm TL), and it is possible that crustaceans are part of neonates or small juveniles diet.

Although O. maculatus was reported to mature at about 60 cm (Compagno, 2001), this size-at-maturity is likely to be related to the dwarf morph from WA, whereas O. maculatus matures at about 120 cm (Huveneers et al. 2007b). Similar to O. ornatus and O. halei, O. maculatus has a triennial reproductive cycle with follicles taking two years to enlarge before ovulation. During the first year, follicles remain small, then grow rapidly during the second year prior to ovulation during November. Gestation lasts about 10?11 months with parturition occurring during September?October (Huveneers et al. 2007b). O. maculatus is lecithotrophic viviparous with a litter size of about 21 with up to 37 young recorded (Grant 1978) and a size-at-birth of about 23 cm TL (Huveneers et al. 2007b). Maximum length is about 320cm, but with most individuals caught being smaller, up to 150?180 cm (Compagno 2001).

Age and growth of O. maculatus was attempted but could not be verified or validated (Chidlow, 2003, Huveneers 2007). Furthermore, different age estimations for wobbegongs were obtained if using whole vertebrae or thin cut sections (Huveneers 2007). Newborn captive O. Maculatus grew about 22 cm year-1, whereas small juveniles of about 45 cm TL grew about 18 cm year-1 (Huveneers 2007).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - 110 m (Ref. 247), usually 0 - ? m (Ref. 55261)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spotted wobbegong are bottom-dwelling sharks found in marine environments ranging from temperate to tropical. Their main habitat consists of inshore areas near the continental shelves, from the intertidal zone down to depths of 110 meters (Pollard et al, 2003). More specifically, spotted wobbegong inhabit coral and rocky reefs, estuaries, seagrass beds, coastal bays, and areas with sandy bottoms. They are a primarily nocturnal species, and are found in caves, under the overhangs of rocky and coral reefs, and in shipwrecks during the day. Juveniles are commonly found in estuaries and seagrass beds. There has been limited evidence for site attachment, and it is quite common to find a spotted wobbegong in water barely deep enough to cover its body (Eagle, 2005).

Range depth: 0 to 110 m.

Habitat Regions: temperate ; tropical ; saltwater or marine

Aquatic Biomes: benthic ; reef ; coastal

Other Habitat Features: estuarine ; intertidal or littoral ; caves

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 35.5 - 142
  Temperature range (°C): 14.861 - 14.861
  Nitrate (umol/L): 1.026 - 1.026
  Salinity (PPS): 35.526 - 35.526
  Oxygen (ml/l): 5.407 - 5.407
  Phosphate (umol/l): 0.254 - 0.254
  Silicate (umol/l): 1.461 - 1.461

Graphical representation

Depth range (m): 35.5 - 142
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 110m.
Recorded at 110 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The spotted wobbegong inhabits temperate to tropical waters, from the intertidal zone down to depths of at least 110 meters. It is most common on algae-covered rocky reefs, but also occurs over coral reefs, sandy expanses and seagrass beds. It can be found in coastal bays, estuaries, under piers, and even in tidepools, where it has been observed climbing over rocks between tidepools with its back out of the water. Juveniles occur on low reefs, in seagrass beds, and in estuaries (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found on the continental shelf (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Spotted wobbegong, like most sharks are carnivorous and feed primarily on bottom dwelling invertebrates (Compagno, 2002). Their invertebrate prey includes crabs, lobsters, and octopus (Campbell, 2005). Spotted wobbegong also prey on some bony fishes inclusing Serranidae (sea bass), Scorpaenidae (scorpionfishes), and Kyphosidae (luderick). They may also prey on other, smaller shark species, including individuals of their own species, as well as some ray species.

Spotted wobbegong appear to feed primarily by sitting and waiting for unsuspecting prey that may even nibble on the shark’s dermal lobes before the shark will strike (Compagno, 2002). It is believed that the short broad mouth and large broad pharynx aids in sucking in prey. Based on video footage, prey is sucked into the mouth as the pharynx opens and water rushes in. This feeding mechanism in spotted wobbegongs is very similar to that of Squatinidae (angel sharks) except that the prey in angel sharks is taken from above as opposed to in front of the mouth as it is in spotted wobbegong.

Spotted wobbegong are more specialized for jaw protrusion than are most other shark species (Wu, 1994). The palatoquadrate and Meckel’s cartilage project anteriorly and are the major component of protrusion. The movement of these two components simultaneously enlarges the oral cavity to generate the majority of the suction forces. This extra protrusion and enhanced suction force combined with the powerful jaws and multiple rows of enlarged fang-like teeth in the upper and lower jaw (Compagno, 2002), form a deadly trap that spotted wobbegongs use to impale and kill their prey.

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods)

  • Wu, E. 1994. Kinematic Analysis of Jaw Protusion In Orecolobiform Sharks - A New Mechanism For Jaw Protrusion In Elasmobranchs. Journal Of Morphology, 222/2: 175-190.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

The main ecosystem role played by spotted wobbegong is as a dominant predator, preying on the organisms listed above. They are a prey item for humans and for larger aquatic animals. Spotted wobbegong are also a host for a number of parasitic organisms. Thirty-three species of the onchobothriid tetraphylliean cestode (Cestoda) are parasitic to its spiral intestine (Eagle, 2005). Also, the nematode Echinocephalus overstreeti is a known parasite of the spotted wobbegong.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Any large fish or marine mammal is a potential predator of spotted wobbegong (Eagle, 2005). The most dangerous predator to spotted wobbegongs is humans, and if wobbegong meat continues to gain in popularity, the stability of the spotted wobbegong population may be in jeopardy. Their main anti-predatory adaptation is their cryptic coloration pattern, but in addition to their camouflage, spotted wobbegong can become dangerously aggressive if attacked, and have the ability to seriously injure, if not kill, the attacker.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Spotted wobbegongs sense their environment with both chemical and visual cues. The only form of communication yet documented among spotted wobbegongs takes the form of chemical pheromones released by females during the breeding season (Eagle, 2005). Females use the pheromones to attract potential mates.

Most sharks are capable of sensing their environment through electroreception. Most have electrosensors called ampullae of Lorenzini situated in clusters around the head that can sense the weak electrical currents associated with the functioning of nerves and muscles of living animals (Carrier, 2005). The presence of these ampullae in spotted wobbegong has yet to be confirmed, but it is presumed they possess electroreception capabilities.

Communication Channels: chemical

Perception Channels: visual ; chemical ; electric

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Ovoviviparous, embryos feed solely on yolk (Ref. 50449). One female had 37. Size at birth about 21 cm. Some anecdotal accounts regarding courtship are given. It is said that males in captivity fight vigorously among themselves while courting females. In the process, females are bitten by males in the gill region and one clasper is inserted. In the wild, the males are attracted to the females by some chemical pheromones possibly released by the latter during the breeding season.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Development

Spotted wobbegong, like most other sharks, continue to grow throughout their lives and at a relatively slow pace (Eagle, 2005).

Development - Life Cycle: indeterminate growth

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Little is known about the lifespan of spotted wobbegong. However, based on information about sharks in general, it is presumed that spotted wobbegong are relatively long lived animals. They fall prey to only a few predators, outside of humans, and,, as long as sufficient prey is available, spotted wobbegongs should live long, healthy lives.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Little is known about the natural breeding season of spotted wobbegong but, in captivity, breeding usually occurrs during July (Compagno, 2002). This may or may not be indicative of the natural breeding season and further research is necessary. During breeding season, the males are attracted to chemical pheromones released into the water by females. During copulation, the male will bite the female in the gill region, and use his modified pelvic fin, called a clasper, to insert sperm into the cloaca (Eagle, 2005). In captivity males fight fiercely over opportunities to court females, but it remains unclear if this male-male competition occurs among wild populations (UN Atlas of the Oceans, 2005). Unfortunately, little is known about the mating system of spotted wobbegong, but based on their behavior during breeding season, including the male-male competition, it would not be unexpected if they are a polygynous species.

Mating System: polygynous

Spotted wobbegong are ovoviviparous, meaning the eggs develop within the maternal body without additional nourishment from the parent and hatch within the parent or shortly after laying. Pups are unnourished while developing inside the mother and often eat unfertilized eggs as well as other pups. Litter sizes are usually large, with over twenty pups on average, the highest number of pups ever reported was 37 from a single female (Compagno, 2002). The young leave their mother almost immediately after birth, often to avoid being eaten by her. Little is known about the length of gestation for spotted wobbegong, but the maximum for the Orectolobidae family is 2 years. The average age at maturation for both male and female wobbegongs is unknown.

Breeding interval: Breeding intervals in spotted wobbegong are unknown.

Breeding season: Breeding occurs primarily in July in captivity.

Range number of offspring: 37 (high) .

Average number of offspring: 20.

Range gestation period: 24 (high) months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); ovoviviparous

All parental investment among spotted wobbegongs is made by the female, and all investment occurs while the young are still developing inside the mother. Newborn pups are immediately independent after birth and are capable of fending for themselves (Compagno, 1984).

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Orectolobus maculatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTATATTTAATCTTCGGTGCATGAGCAGGAATAGTAGGTATAGCCCTCAGCCTTCTAATTCGAGCAGAACTAAGCCAACCAGGGTCACTCCTAGGTGATGATCAGATTTATAATGTGATTGTAACAGCCCACGCTTTTGTAATAATTTTCTTTATAGTTATACCCGTAATAATCGGTGGATTTGGAAATTGATTGGTACCATTAATAATTGGTGCACCCGACATAGCATTCCCTCGGATAAATAACATAAGTTTTTGACTCCTCCCTCCATCATTTTTATTATTATTAGCTTCTGCCGGAGTAGAAGCTGGTGCAGGAACAGGTTGAACAGTTTATCCACCATTAGCGGGTAATTTAGCTCACGCCGGAGCATCAGTCGACTTAACAATCTTCTCTCTTCACTTAGCAGGAATTTCATCAATTTTAGCATCTATTAATTTTATTACAACCATTATTAACATAAAACCACCAGCTATCTCTCAATATCAAACACCTTTATTTGTTTGATCAATTCTTGTAACCACAATCCTCCTCCTACTAGCATTACCAGTTTTAGCGGCTGGAATTACTATGCTCTTAACCGACCGCAATCTAAACACAACATTCTTTGACCCAGCAGGAGGAGGAGATCCTATTCTTTATCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Orectolobus maculatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Huveneers, C. Pollard, D., Gordon, I., Flaherty, A. & Pogonoski, J.

Reviewer/s
Valenti, S.V. & IUCN SSG Australia and Oceania Red List Workshop participants (Shark Red List Authority)

Contributor/s

Justification
The wobbegongs Orectolobus ornatus and O. aculatus were assessed on the 2003 Red List of Threatened Species as Near Threatened globally. Recent studies, however, have provided new biological and ecological information while previous taxonomic uncertainties in NSW have now been resolved, elevating O. Halei to species level (previously believed to be the adult form of O. ornatus). This assessment presents updated documentation for O. maculatus.

The Spotted Wobbegong (Orectolobus maculatus) is probably an Australian endemic species (pending taxonomic review). Previous records from Japan and South China Sea could be different species of wobbegongs. A biologically vulnerable species, site-attached within its relatively shallow water range (0?218 m) and caught in commercial and recreational fisheries as a target species and as bycatch. Historic catch data are aggregated between wobbegong species, but serious declines (>50% between 1990/1991?1999/2000) for Ornate Wobbegong (O. ornatus), O. maculatus and Banded Wobbegong (O. halei) are documented for the east coast (New South Wales). Catches have since stabilized, however, species-specific catch-per-unit-effort data are unavailable due to inaccurate reporting of fishing effort and aggregation of wobbegong species in catch records. Until late 2006, there were no management strategies specifically regulating the wobbegong commercial fishery in NSW. Since September 2006, wobbegongs have been included in the daily trip limit for a specific list of shark species to one tonne for a 24 hour period and two tonnes for 48 hours or greater. Furthermore, a minimum size limit of 130 cm TL and a maximum trip limit of either six or 12 wobbegongs (including O. halei and O. ornatus) will also be implemented and is pending approval by the NSW Fisheries minister. Given the targeted wobbegong fishery, documented decline in catches and previous lack of management regulations, O. maculatus is classified as Vulnerable in NSW. Wobbegongs are not targeted and catches are low in other Australian states (Western Australia, Queensland, South Australia, and Victoria). However, given that localised depletion is possible due to wobbegong?s slow reproductive cycle (triennial) and long residency within small geographical areas, and that O. maculatus is caught across its range, O. maculatus is classified as Near Threatened globally. More information is needed on catch composition, fishing effort, age and growth and population structure to develop stock assessments and demographic analyses. Wobbegong resilience to fishing pressure could then be calculated and used to recommend future conservation and management decisions. Monitoring of catches will also be required due to the recent management regulations that have been introduced in NSW, limiting fishing pressure on wobbegongs. Reassessment might then be required in light of this new information.

History
  • 2003
    Near Threatened
    (IUCN 2003)
  • 2003
    Near Threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

According to the IUCN Species Survival Commission, spotted wobbegong are considered near threatened, meaning the species has been evaluated but does not fit criteria for critically endangered, endangered, or vulnerable at the current time (Pollard et al, 2003). Spotted wobbegong are not currently listed on the United States Endangered Species Act list as either endangered or threatened. The Convention of International Trade in Endangered Species of Wild Fauna and Flora (CITES) also gives no special status to spotted wobbegongs.

Spotted wobbegong are commonly caught as bycatch and there appears to be low and stable catch levels in southern and western coastal fisheries (Pollard et al, 2003). However, serious declines have occurred in New South Wales which demonstrates the vulnerability of spotted wobbegongs to exploitation. Recreational fishing does not appear to be a dangerous threat to spotted wobbegongs, however spearfishers do catch a small number. The potential site attachment of spotted wobbegongs adds to their vulnerability to fishing pressure. This species has been targeted for their decorative skin pattern in the past, but are currently no longer being caught for their skin.

Spotted wobbegongs may be susceptible to damage to their inshore coastal habitats. Estuaries and seagrass beds may be home to important nursery areas for juvenile spotted wobbegongs (Pollard et al, 2003).

There is ongoing discussion regarding the management of spotted wobbegongs in the New South Wales area, but no management plan has yet been put in place (Pollard et al, 2003). Currently, there are no species-specific management plans in place in other Australian states. Some spotted wobbegong habitat areas may fall under the protected areas for Odontaspis ferox (grey nurse sharks) in New South Wales. Spotted wobbegongs also occur in a few other marine protected areas in New South Wales, including Julian Rocks Aquatic Reserve, Solitary Islands Marine Park, Fly Point-Halifax Park Aquatic Reserve, and Jervis Bay Marine Park. Very recently, an in-possession limit of two spotted wobbegongs per person was instituted for recreational fishers (Pollard et al, 2003).

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Near Threatened (NT) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
No evidence of subpopulations. However, as stated above, a potential dwarf population of O. maculatus occurs in WA. A genetic study looking at orectolobid phylogeny and phylogeorgaphy and assessing potential stock structure is currently being undertaken (S. Corrigan pers. comm.).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Commercial fishing is probably the main cause of the decline of this species in eastern Australia. Furthermore, observed site fidelity is likely to increase wobbegong?s susceptibility to fishing pressure. On an Australia-wide basis, wobbegong sharks are commonly caught in trawls, beach seines, gillnets, lobster pots and traps, by hook-and-line, and also by spearfishing. The flesh is now highly regarded as food, but in the past has generally been of only limited commercial value. Historically, the attractive skin has been used as decorative leather (Last and Stevens 1994). However, it is unknown if this practice is still occurring.

In NSW, three Orectolobus species (O. maculatus, O. ornatus and O. halei) are taken in the Ocean Trap and Line Fishery (OTL), in the fish and prawn sectors of the Ocean Trawl Fishery, and very few in the Estuary General Fishery. The majority of commercial wobbegong catches occur in the OTL Fisheries, where they have historically been taken as both a target species by setline methods and as by-product by other methods (NSW Department of Primary Industries, unpub. data). Serious declines have been observed in NSW, demonstrating the vulnerability of this species to exploitation. The NSW total catch of wobbegongs (genus Orectolobus), combining all fishing methods and fisheries, has declined from about 120 tonnes in 1990/1991 to about 55 tonnes in 1999/2000, representing a decrease of about 55% in less than a decade (Pease and Grinberg 1995, NSW Department of Primary Industries unpub. Data). However, catches have since stabilised, and range 55?73 tonnes during 1998/1999?2003/2004. Fishing effort is mostly unknown and inaccurate because it has only been reported as the number of days fished. Additionally, the historical aggregation of the wobbegong species in catch data is a further complicating factor. Species-specific catch-per-unit-effort, required to obtain a more accurate estimation of wobbegong catches, is therefore unavailable. Although the strong decline in catches should be of concern for the resilience of wobbegongs to strong fishing pressure, the number of fishers landing wobbegongs has also decreased from about 520 in 1990/1991 to about 250 in 2003/2004 (NSW Department of Primary Industries unpub. data).

Commercial fishing by a variety of methods is potentially threatening wobbegong species in southern Australian waters. In southern Australia, wobbegongs are taken within the Southern and Eastern Scalefish and Shark Fishery (SESSF) (AFMA logbook data, unpub. Data). Most of the above fisheries take these species as bycatch, and like many bycatch species they are often utilised. Retained wobbegong from the Commonwealth Fisheries ranged 2.3?5.1 tonnes between 1994 and 1999.

Orectolobus maculatus and O. halei are a component of the bycatch of a commercial shark fishery utilising demersal gill-nets that target carcharhinid whalers and other sharks along the southern and lower west coasts of Western Australia with an average total wobbegong catch between 1999 and 2006 of about 45 tonnes year-1 (range 35?68 tonnes) (Simpfendorfer and Donohue 1998, Penn 2001, McAuley and Lenanton 2003, McAuley and Gaughan 2004, Gaughan and Chidlow 2005, McAuley 2006, McAuley 2007). Smaller catches of orectolobids also occur in commercial and recreational rock lobster pots throughout temperate coastal Western Australian waters (J. Chidlow, pers. comm.).

Commercial catches of wobbegong are small in most parts of South Australia (about 0.5?2.5 tonnes) with the highest yearly catch being 3.1 tonnes in 1987/88.

Wobbegongs are not targeted in Queensland. O. halei has been recorded in low numbers in the bycatch of prawn trawl fisheries (Kyne et al. 2002), whereas small wobbegongs are sometimes caught by crab pots in Southeast Queensland and Moreton Bay, but are usually discarded (J. Stead pers. comm.).

The National Recreational and Indigenous Fishing Survey (Henry and Lyle 2003) reported that 5,174 wobbegongs (all species combined) were caught and kept by recreational fishers in southern Australian states during the survey time period (May 2000?April 2001), comprising 1,944 from NSW, 999 from Queensland, 252 from SA, and 1,978 from WA. In Western Australia, a WA Fisheries Department survey conducted in 1996?1997 between Augusta and Kalbarri, reported that up to 1,000 wobbegongs were caught and kept by recreational fishers during that period (Sumner and Williamson 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wobbegong sharks are commonly caught in commercial and recreational fisheries, both as a target species and as by-catch (5). Its flesh is now highly regarded as food, and the attractively patterned skin has been used as decorative leather (5), although is not currently targeted for this purpose (1). As a result of these fisheries, numbers of the spotted wobbegong have declined significantly in New South Wales. Combined with the closely related banded wobbegong (Orectolobus ornatus), catches declined by over 60 percent between 1990 and 2000 (5). Whilst catches in southern and western Australia appear to be low and stable, the impact of fisheries on the east coast population indicate how vulnerable this species is to over-exploitation (5). The spotted wobbegong may also be threatened by habitat degradation, as estuaries and seagrass beds may be important nursery areas for this species (4), which could be impacted by coastal developments and pollution.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
As a result of the observed decline in NSW wobbegong catches, a discussion paper on wobbegong sharks was produced, seeking the views of various stakeholders on the future management of commercial and recreational fishing of wobbegong sharks (NSW Fisheries 2001). However, the management plan has not been finalised and management measures have not been implemented. NSW Department of Primary Industries (NSW DPI) also requested commercial fishers to report catches for O. ornatus and O. maculatus individually. Most recently, a review of NSW Recreational Freshwater & Saltwater Fishing Rules and the Fishery Management Strategy (FMS) for NSW Trap and Line Fishery have proposed a minimum size limit of 130 cm TL for wobbegong sharks and a trip limit of 12 wobbegongs caught in fish traps (NSW DPI 2006). The FMS has also recommended that commercial fishers report their catches of each species separately and to collect additional biological data through the observer program.

Until late 2006, there were no management strategies specifically regulating the wobbegong commercial fishery in NSW. The only regulation in place was a recreational bag limit of two wobbegongs per day (later reduced to zero in September 2007) and a commercial gear limit of no more than ten lines each with a maximum of six hooks when setlining within three nautical miles of the coast. There were no gear limits outside three nautical miles, but as of 2008, amendments to the share management plans will instate a maximum of 1,200 hooks and 30 traps per endorsement holder.

Since September 2006, wobbegongs have been included in the daily trip limit for a specific list of shark species to one tonne for a 24 hour period and two tonnes for 48 hours or greater. NSW DPI also recommended that fishers in the Ocean Trap and Line and Lobster fisheries have in their codes of practice to release wobbegongs less than 130 cm TL caught in fish traps. Since July 2007, the use of wire trace, or other trace made of metal type materials, is prohibited to decrease instances of gut-hooking. Furthermore, a minimum size limit of 130 cm TL and a maximum trip limit of either 6 or 12 wobbegongs (including O. halei and O. ornatus) will also be implemented and is pending approval by the NSW Fisheries minister.

Site attached species may also benefit from habitat protection and suitably designed and implemented "No-take" MPAs, where all forms of harvesting or fishing are excluded. Some protection may be offered by those protected areas already being implemented for grey nurse sharks Carcharias taurus in NSW.

Australian Marine Protected Areas in which the species occurs:
Great Sandy Marine Park, Qld
Moreton Bay Marine Park, Qld
Cape Byron Marine Park, Byron Bay, northern NSW
Julian Rocks Aquatic Reserve, off Byron Bay, northern NSW
Solitary Islands Marine Park, north of Coffs Harbour, NSW
Port Stephens-Great Lakes Marine Park, north of Sydney, central NSW
Jervis Bay Marine Park, south of Sydney, NSW
Batemans Marine Park, south of Sydney, NSW
Shark Bay Marine Park, WA
Ningaloo Marine Park, WA
Jurien Bay Marine Park, WA
All Victorian marine parks
All South Australian marine parks

Possibly also occurs in the following areas:
Hamelin Pool Marine Nature Reserve, WA
Shoalwater Islands Marine Park, WA
Marmion Marine Park , WA
Muiron Islands Marine Management Area, WA
Rowley Shoals Marine Park , WA

Further protected areas might be necessary to ensure stable populations and are likely to be efficient due to the high site fidelity of wobbegong (Huveneers et al. 2006).

Recreational fishers may also have had an impact on this species in the past. An in-possession limit of two wobbegong sharks per person was introduced for recreational fishers in NSW and reduced to zero in September 2007. This new regulation may help to alleviate any adverse affects caused by recreational fishing practices.

Although a PhD project investigated the biology and ecology of wobbegong sharks, as suggested by the previous Red List assessment, catch and effort is still poorly recorded preventing adequate stock assessments. Species-specific catches in addition to accurate effort data is required to correctly determine population status of wobbegong.

The improvement of species identification in catch records and a better understanding of biological parameters, including validation of age and growth are crucial in providing accurate data upon which to base stock assessments and demographic analyses. Outcomes from which can then be used to estimate wobbegong resilience to fishing pressure and recommend future conservation and management decisions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The spotted wobbegong is assessed as Vulnerable in New South Wales, Australia, however no management plan is yet in place for this population, and there are apparently no specific conservation measures in place in any of the Australian states (5). It may gain some level of protection from the protected areas being designated for grey nurse sharks in New South Wales, and it occurs in several Marine Protected Areas throughout its range (5). An in-possession limit of two wobbegong sharks per person was recently introduced for recreational fisheries, and it is hoped that this may help lessen the impact of recreational fishing practices (4). It has been suggested that further information on the biology, ecology and status of the species is required to enable the development of suitable management policies (4) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Spotted wobbegong are commonly caught by trawls and trammel nets, and inside lobster nets and pots (UN Atlas of the Oceans, 2005). They are considered pests in the lobster industry because they squeeze themselves inside lobster traps to eat both the bait and the catch. Spotted wobbegong are relatively docile sharks, and appear relatively sluggish when viewed by divers, but they should still be considered dangerous. They are not generally considered an aggressive species of shark, but have been known to bite people if provoked. In most cases, bites result when the shark is stepped on or if someone steps too close to their mouth and may be mistaken for prey (UN Atlas of the Oceans, 2005). Spotted wobbegong will assuredly become aggressive when speared or caught by nets. Their strong jaw musculature and impaling teeth, when combined with their tendency to hold on after biting, enables them to inflict serious damage. Several bites by wobbegong, both provoked and unprovoked, including bites on divers, have been reported. There have even been reported instances of a wobbegong biting fishing boats; some victims have lost limbs to the bite of a wobbegong. However, it is difficult to say which wobbegong species was responsible or the exact circumstances that led to these incidents.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Although there is a limited amount of interest in the creation of a spotted wobbegong fishery, they are still commonly consumed by humans (Compagno, 2002). The meat is apparently excellent for eating and is mildly popular in Australia and surrounding areas. The tough skin makes very durable, decorative leather due to the unique patterning. Among the scuba diving industry, spotted wobbegongs are relatively easy and safe to observe by the average diver, thus contributing to the ecotourism of the area.

Positive Impacts: food ; body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Spotted wobbegong

The Spotted Wobbegong, Orectolobus maculatus, is a carpet shark in the family Orectolobidae, found in the eastern Indian Ocean from Western Australia to southern Queensland, between latitudes 20° S to 40° S. It reaches a length of 3 meters (9.8 feet).[1]

See also[edit]

References[edit]

  1. ^ Kindersley, Dorling (2001,2005). Animal. New York City: DK Publishing. ISBN 0-7894-7764-5. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!