Overview

Comprehensive Description

Description

  Common names: shark (English), tiburón (Espanol)
 
Odontaspis ferox (Risso, 1810)


Ragged-tooth shark     Smalltooth sandtiger shark,     Bumpytail ragged-tooth shark


A large shark with a robust body; head with long, bulbously conical snout; eyes moderately large, without nicitating eyelids; mouth relatively long, extending behind eyes; 5 gill slits, all before pectoral; teeth moderately large with prominent dagger-like middle point and 2-3 small points on either side; first dorsal fin much nearer pectorals than pelvics; second dorsal fin noticeably smaller than first dorsal, its origin over or slightly behind pelvic insertion, tail fin asymmetrical with moderate subterminal notch and strong ventral lobe.

Medium grey on back, light grey below; young with black tips on dorsal fins.

Size: reaches 410 cm.

Habitat: rocky shores.

Depth: 10-530 m.

Circumglobal in mainly subtropical waters; in the eastern Pacific it is known from Southern California to the western Gulf of California; recently discovered at Malpelo, where it may have a resident population.   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Found on or near the bottom of the continental and insular shelves and upper slopes (Ref. 6871); sometimes in shallow water (Ref. 6871). Tagging showed the species dives up to 2,000 m at Malpelo Island, Colombia (S.Bessudo, pers.comm. 06/09). Feeds on small bony fishes, squids, and crustaceans (Ref. 13568). Uses its long body cavity and large, oily liver to regulate buoyancy. Ovoviviparous, embryos feeding on yolk sac and other ova produced by the mother (Ref. 50449). Not implicated in attacks on people (Ref. 247). Flesh utilized for human consumption and liver for its high squalene content (Ref. 247); utilization of fins, jaws and cartilage (Ref.58048).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Records show a very disjunct distribution throughout most of the world's oceans. Overall, the latitudinal range of O. ferox is between 46oN in the Bay of Biscay (Debrosses 1930) to around 38-39oS in the Indian and Pacific Oceans. Recorded in the Northeast Atlantic Ocean, the Indian Ocean (including the Cocos-Keeling Islands (Australian Territory)), and the Western Pacific, Central Pacific and Northeast Pacific Oceans.

The first record for the Northwest Atlantic Ocean was in 1989 (Bonfil 1995) and voucher specimens have also been recorded off North Carolina (USA) and Mexico (in the North West and West Central Atlantic). The species has also been reported from Brazil in the South West Atlantic; the first record was based on jaws collected by fishers off Natal, Rio Grande do Norte (Menni et al. 1995, Soto 2001) and there are subsequent records from the Archipelago of Fernando de Noronha (03°52?S, 32°25?W) off north-eastern Brazil (Garla and Garcia Jr. 2006). In the Northeast and East Central Atlantic, O. ferox has been recorded from the Bay of Biscay, Madeira, Azores, Canary Islands, Morocco, Western Sahara and widespread in the Mediterranean Sea. In the Indian Ocean, from South Africa (KwaZulu-Natal), northeast and southeast of Madagascar in open ocean, Tanzania, El Dabra in the Mozambique Channel, Madagascar, Maldives, open ocean southeast of Sri Lanka, southwest of Sumatra and Cocos-Keeling Islands (Compagno 2001). In the Western Pacific, from Japan, Australia (New South Wales, eastern Victoria), New Zealand (North Island) and the Kermadec Islands (Fergusson et al. 2008), although it is probably more widespread in north-eastern Australian waters than voucher specimens would indicate (P. Last, pers. comm.). In 2004, a large female was caught by an orange roughy trawler in 880m on the Louisville Ridge over 600 nm east of New Zealand (M. Francis, pers. comm.). In the Central and Eastern Pacific, from the Hawaiian Islands, southern California (USA), Mexico and Colombia (Compagno 2001). Photographs taken by divers at Malpelo Island off Columbia have also confirmed the presence of O. ferox in the Gulf of Panama. Diver sightings have also been reported on isolated deep reefs in various other locations.

In the Mediterranean there are published records from Spain and the Balearic Islands (Lozano Rey 1928), Algeria (Moreau 1881, Dieuzeide et al. 1953), northern Tunisia (Capapé et al. 1975), Italy (Giglioli 1880, Tortonese 1956, Vacchi and Serena 1997), Pelagic Islands (Zava and Montagna 1992), the Adriatic Sea (Soljan 1975, Morovic 1976, Soldo and Jardas 2002), Greece and the Aegean Sea (Economidis 1973, Papaconstantinou 1988), and Lebanon (George et al. 1964, Ben-Tuvia 1971, Mouneimne 1977). Mediterranean sites apparently favoured by O. ferox are typically located either along the coasts of islands lying contiguous to deepwater, near offshore seamounts or at mainland localities where continental shelves are narrow, e.g., within the Tyrrhenian Sea, around Sicily, off south-western Malta, off Lebanon, off the southern coast of Cyprus, and around the Dodecanese and Cyclades island groups of the Aegean Sea. Originally recorded off Lebanon by George et al. (1964), O. ferox is now repeatedly observed by divers near Beirut, where it had previously been misidentified as Carcharias taurus. The status of this shark in North African waters of the Mediterranean is patchily known. A small number of specimens are reported and confirmed by preserved dentition from Algerian fisheries (F. Hemida, USTHB/ISN, Algiers, pers. comm.), and literature and contemporary records for Tunisia are equally scant (Capapé et al. 1976). However, specimens are likely still landed at Tunisian ports, from fisheries operating throughout the Sicilian Channel. There is no contemporary data for this species in Libyan or Egyptian waters but it may occur in the slope waters of the southern Levantine Basin.

In South Africa this species is known from a few juvenile specimens recorded from trawls on the outer edges of the continental shelf, off the east coast (Natal) (Bass 1978). Small numbers were observed caught on longline gear at about ~300 m along the south KwaZulu Natal coast, South Africa, in the late 1980's, and further anecdotal information indicates relatively frequent capture of these sharks (of approx 2 m TL) during target fishing for deep-sea sharks and rays (D. Ebert, pers. comm. 2004). Forster et al. (1970) caught what appears to be a large female of O. ferox in deep water off the northeast of Madagascar. There have been unconfirmed, but reliable, reports of sightings of small aggregations of O. ferox around deepwater drop-offs off the Transkei coast in South Africa by divers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East), East Pacific + Atlantic (East +/or West), East Pacific + East (not West) Atlantic

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California province, primarily, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), Antitropical (North and South temperate)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Atlantic: Gulf of Gascony, Madeira, Morocco, Mediterranean; also Cape Verde (Ref. 27000). Western Atlantic: Yucatan Shelf, Mexico (Ref. 9939), Brazil (Ref. 53443). Indo-West Pacific: off South Africa and Maldives, Madagascar, southern Japan, Australia, and New Zealand (Ref. 13568). Expected to occur in the Western Central Pacific (Ref. 13568). Central Pacific: off Hawaii (Ref. 13568). Eastern Pacific: off southern California, USA and Baja California, Mexico (Ref. 13568).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nearly circumglobal in tropical and temperate waters (including Mediterranean Sea, Hawaiian Islands).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 10 (S) - 530 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 410.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 3670 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

450 cm TL (male/unsexed; (Ref. 89422)); max. published weight: 289.0 kg (Ref. 9939)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Found on the continental and insular shelves. Feeds on small bony fishes, squids, and shrimps. Reproduction is unknown but presumably similar to @C. taurus@. Uses its long body cavity and large, oily liver to regulate buoyancy. Not implicated in attacks on people. Utilized for human consumption and for its liver which has a high squalene content.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

A shark with a short, pointed snout, small eyes, protruding spike-like teeth, and small, equal-sized dorsal and anal fins; first dorsal closer to pectoral than to pelvic fins (Ref. 5578). Grey above, paler below (Ref. 6586); may have red spots on sides (Ref. 5578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This shark is a little-known inhabitant of deepish water in warm-temperate and tropical seas, on or near the bottom on continental and insular shelves and upper slopes at depths of 13 to 420 m, also possibly epipelagic zone in 140 to 180 m over the ocean floor. Sometimes observed by divers near dropoffs on coral reefs.
  • Compagno, L.J.V. (2001). Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Volume 2. Bullhead, mackerel and carpet sharks (Heterodontiformes, Lamniformes and Orectolobiformes). FAO Species Catalogue for Fishery Purposes. No. 1, Vol. 2. Rome, FAO. 269p.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Odontaspis ferox is a rarely encountered species that is morphologically very similar to Carcharias taurus, but larger and bulkier and mostly found in deeper water. It is an active-swimming offshore shark, caught and seen as individuals and in small groups (Compagno 2001). Odontaspis ferox lives on or closely associated with the bottom in or adjacent to deep waters along continental and insular shelves and upper slopes to depths to about 850 m (Fergusson et al. 2008). However, it is occasionally observed in very shallow water. For example, divers filmed underwater video of an individual in 20 m of water at the Cocos-Keeling Islands (B. Hutchins, pers. comm., cited in Fergusson et al. 2008). More recently, one capture and several diver observations and photographs of O. ferox in 12?30 m depth at Fernando de Noronha Archipeligo off eastern Brazil were reported by Garla and Garcia Jr. (2006). There are at least 15 records from pelagic zones in open waters of the Indian and Pacific Oceans, typically in areas proximal to deep-sea ridges and seamounts. Sightings have also recently been made in depths of about 30 m, on reefs adjacent to deep drop-offs in Lebanon and possibly off the Transkei coast in South Africa (Fergusson et al. 2008).

Little is known of the biology of this shark. Its reproduction may be similar to that of the sand tiger shark (C. taurus). Compagno (2001) cites an observation which suggests the species practices uterine cannibalism in the form of oophagy, resulting in the birth of single embryos from each uterus. The smallest recorded O. ferox is 107 cm total length (TL) which suggests a birth size between 100 and 110 cm TL (Fergusson et al. 2008), a size proportionally consistent with the size at birth for the smaller C. taurus (95-105 cm TL, Compagno 2001). O. ferox probably has a non-continuous breeding cycle similar to, or possibly more extended than, C. taurus. The gestation period for C. taurus is 9-12 months with a probable rest year between pregnancies (Compagno 2001).

There are insufficient data to precisely define the size at maturity for O. ferox. Males were estimated to mature between 200 and 250 cm and females between 300 and 350 cm total length (Fergusson et al. 2008) The maximum recorded size for females is 450 cm TL and 344 cm TL for males (Fergusson et al. 2008). An analysis of 64 O. ferox captures worldwide suggests an inverse relationship between shark size and depth, with small juveniles almost exclusively occurring in deepwater (>200m), although the relationship is not strongly defined (R2 = 0.129; p < 0.05; Fergusson et al. 2008). Mature sized O. ferox were caught across their whole depth range (15-850 m) but all small juveniles (<150 cm TL) came from depths greater than 200 m suggesting that parturition occurs in relatively deep water.

The large oily liver probably has a hydrostatic function (Last and Stevens 1994), and may help the shark to maintain neutral buoyancy while swimming. Stomachs examined have contained small bony fish, cephalopods, crustaceans (Last and Stevens 1994, Bass et al. 1975), and small squalid dogfish. A 188 cm female from near New Plymouth, New Zealand, had ?the tip of the spine of a small ghost shark (Chimaeridae) impaled in its lower jaw cartilage? (Stewart 1997). A very large O. ferox trawled on the Norfolk Ridge north of New Zealand in 1997 was found to contain a 200 cm seal shark in its stomach. The above information suggests that this species is an opportunistic carnivore (Stewart 1997, cited in Pogonoski et al. 2002). Dentition suggests a more uniform diet of softer prey than in C. taurus (Compagno 2001). Stomachs were empty in specimens examined from the Gulf of Mexico (Bonfil 1995), Malta (A. Buttigieg, pers. comm.), the Azores (P.N. Duarte, pers. comm.), Canary Islands (A. Hernández, pers. comm.), and NSW (K. Graham data, N. Otway, pers. comm.). The only confirmed predator on adult O. ferox is the Cookie-cutter Shark (Isistius brasiliensis), based upon a relatively recent (March 2000) record of a female in the Canary Islands bearing a single fresh cookie-cutter bite to the gills (A. Hernández, pers. comm.).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; marine; depth range 10 - 2000 m (Ref. 26346), usually 13 - 880 m (Ref. 89422)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 8 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 155 - 850.5
  Temperature range (°C): 5.175 - 15.557
  Nitrate (umol/L): 3.453 - 29.960
  Salinity (PPS): 34.453 - 35.496
  Oxygen (ml/l): 4.131 - 5.279
  Phosphate (umol/l): 0.523 - 2.105
  Silicate (umol/l): 4.997 - 37.296

Graphical representation

Depth range (m): 155 - 850.5

Temperature range (°C): 5.175 - 15.557

Nitrate (umol/L): 3.453 - 29.960

Salinity (PPS): 34.453 - 35.496

Oxygen (ml/l): 4.131 - 5.279

Phosphate (umol/l): 0.523 - 2.105

Silicate (umol/l): 4.997 - 37.296
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 10 - 530m.
From 10 to 530 meters.

Habitat: bathydemersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Near Bottom, Bottom, Bottom + water column

Habitat: Reef (rock &/or coral), Rocks, Reef associated (reef + edges-water column & soft bottom), Water column

FishBase Habitat: Bathydemersal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found on or near the bottom of the continental and insular shelves and upper slopes (Ref. 6871) in 13-420 m (Ref. 58472). Sometimes in shallow water (Ref. 6871). Benthopelagic at 13-420 m (Ref. 58302). Feeds on small bony fishes, squids, and crustaceans (Ref. 13568). Uses its long body cavity and large, oily liver to regulate buoyancy.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), octopus/squid/cuttlefish, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Exhibit ovoviparity (aplacental viviparity), with embryos feeding on other ova produced by the mother (oophagy) after the yolk sac is absorbed (Ref. 50449). Two young born at 105 cm or larger (Ref. 26346). Distinct pairing with embrace (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg Type: Live birth, No pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Odontaspis ferox

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Odontaspis ferox

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATTTAATCTTCGGTGCATGAGCAGGAATAGTGGGAATAGCTTTAAGCCTTCTAATTCGAGCCGAATTAGGCCAACCTGGGTCACTTCTAGGAGATGATCAGATTTATAATGTTATTGTAACCGCCCATGCATTCGTAATAATCTTCTTCATGGTTATACCCGTAATAATTGGTGGGTTTGGAAACTGATTAGTACCATTAATAATTGGTGCACCAGATATAGCCTTCCCACGAATAAATAACATAAGCTTTTGACTTCTACCTCCTTCTTTTCTTTTACTTCTGGCTTCAGCTGGAGTTGAAGCCGGAGCCGGTACTGGTTGAACAGTTTATCCCCCTTTAGCTGGTAACTTAGCACATGCTGGAGCATCCGTTGACTTAGCCATCTTCTCTCTCCATTTAGCAGGCATCTCATCAATTTTAGCTTCAATTAACTTTATTACAACCATTATTAATATAAAACCACCAGCCATCTCTCAATATCAAACACCATTATTTGTGTGATCAATTCTAGTAACAACTATCCTCCTCCTATTATCCCTTCCAGTACTCGCAGCAGGTATTACAATATTACTTACTGATCGCAATCTAAATACAACATTCTTTGATCCAGCAGGAGGAGGAGATCCAATTCTTTATCAACATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2bd+4bd

Version
3.1

Year Assessed
2009

Assessor/s
Pollard, D., Gordon, I., Williams, S., Flaherty, A., Fergusson, I.K., Dicken, M. & Graham, K.

Reviewer/s
Cavanagh, R.D., Valenti, S.V., Dudley, S., Soldo, A. & Francis, M. (Shark Red List Authority)

Contributor/s

Justification
Despite its extensive, almost worldwide, distribution, Smalltooth Sand Tiger Shark (Odontaspis ferox) populations and occurrences are fragmented and the species may be naturally rare. This species is morphologically very similar to Carcharias taurus, although it is larger and bulkier and is presumed to have a very low reproductive capacity, similar to that of C. taurus (producing only two pups every two years). This likely very low reproductive capacity makes it potentially susceptible to local extirpation, even at seemingly small capture rates. Although probably not specifically targeted, there are commercial landings of the species taken in bottom trawls, set-nets and line gear in many areas including the Mediterranean Sea, Japan, and occasionally Australia (although it is now protected in New South Wales). It is generally found in deeper water (down to 880 m depth), but recent observations of small aggregations in shallow water in a number of areas (Mediterranean Sea and Eastern Pacific Ocean) suggests that the species may be more vulnerable to fishing pressure than previously assumed, and potentially susceptible to coastal habitat impacts, similar to C. taurus. Increased demersal trawl fisheries in Australia and New Zealand are now operating in areas of possible and known occurrence. Fishery independent surveys indicate a decline of over 50% in catches off the east coast of Australia (hence the Vulnerable assessment in those waters), probably the result of commercial fishing operations off New South Wales. Similar declines are presumed to have occurred in other parts of its range impacted by fisheries. Given the species? likely very low reproductive capacity, intensive fishing pressure throughout its bathymetric range in the Mediterranean Sea and an absence of management measures there, the decline of O. ferox in this region is suspected to match or even exceed that in Australia, warranting a regional assessment of Endangered. There are very few records from subequatorial Africa, where the species is currently assessed as Data Deficient. Globally, a precautionary assessment of Vulnerable is considered appropriate, as a result of documented and suspected declines, the species? apparent rarity, presumed very low fecundity and high vulnerability to exploitation, and continued by-catch in fisheries.

History
  • 2003
    Data Deficient
    (IUCN 2003)
  • 2003
    Data Deficient
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Listed, Data deficient

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
A fragmented population and relatively few occurrences suggest that this species may be naturally rare. Regional interrelationships between Mediterranean O. ferox and those from other parts of the open Atlantic Ocean (e.g. Azores, Canary Islands) are unknown. Given the cosmopolitan distribution of this species and its occurrence on both sides of the Straits of Gibraltar, the Mediterranean population cannot be considered disjunct based solely on analysis of records of capture. Genetic work is urgently required to assess this further. There have been unconfirmed, but reliable, reports by divers of small aggregations of O. ferox off the Transkei coast in South Africa. These sightings have been in depths of 20-30 m in areas of deepwater drop-offs (similar to those encountered off Lebanon), suggesting that this species may be more vulnerable to fishing pressure than previously assumed. Further investigation and monitoring of commercially caught small O. ferox in this region is required to assess if this is a nursery area. Large females observed off Beirut, apparently in the absence of any males, sometimes exhibit scars that might have been caused during courtship or mating.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Recent evidence of shallow water aggregations in a number of areas (Mediterranean Sea and Eastern Pacific Ocean) suggests that the species may be more vulnerable to fishing pressure than previously assumed, and potentially susceptible to coastal habitat impacts as well as to over-exploitation because of its presumed very low reproductive capacity. Although this species is not specifically targeted by commercial fishing activities, it likely has very low fecundity making it susceptible to local extirpation, even at seemingly small capture rates (Fergusson et al. 2008).

Since the 1970s there has been a substantial increase in deepwater fishing effort worldwide. In particular, significant trawl fisheries have developed on the continental slopes and ocean ridges off Australia, New Zealand and southern Africa, and the now-known depths at which O. ferox commonly lives (300-700 m) are regularly trawled. Similarly, as shallow water fisheries become depleted, fishing gear such as mesh-nets, droplines and longlines are being deployed at increasingly greater depths.

Mediterranean
In the Mediterranean, dedicated efforts to detail captures and other indices of its abundance only began in the past ten years or so, and in particular since 1995. Regional literature and fisheries data concerning historical captures is essentially patchy and lacking in detail, so longer-term trends in its abundance are unknown. Moreover, fisheries records are sometimes confused by the widespread use of similar common names for different Mediterranean species; e.g., 'tiger' shark in Malta may refer to this species or indeed to the Shortfin Mako (Isurus oxyrinchus) or the Sandtiger Shark (Carcharias taurus). Occasionally O. ferox is caught by artisanal fisheries in the Tyrrhenian Sea off Calabria, Italy (M. Vacchi, pers. comm.). The species is uncommon in the Adriatic Sea but its current status there is difficult to assess, because of fishery misidentification with other sharks. Until the mid 1990s, occurrences off Croatia included relatively small (<200 cm TL) specimens caught by trawls and deepwater bottom longlines, which were locally confused with, and marketed as, smoothhound Mustelus spp. (Soldo and Jardas 2002). Since then there have been no more records of the species in the Adriatic (A. Soldo, pers. comm.).

Concern for the status of this shark in the Mediterranean is supported by records from New South Wales (NSW), Australia, where specimens of all sizes were caught by trawling on the upper slope. Survey and commercial catch data suggest that numbers of O. ferox on the NSW trawl grounds have markedly declined (by as much as 50%) since the advent of deepwater commercial trawling in the 1970s. In areas of steep un-trawlable terrain, characteristic of many locations in the Mediterranean Sea, gill-netting and longlining are likely to impact on local populations, with mature individuals being particularly vulnerable. Although O. ferox is not specifically targeted by commercial fishing activities in the Mediterranean and elsewhere, its likely very low fecundity make it susceptible to local extirpation, even at seemingly small capture rates.

Specimens are most often taken nocturnally by bottom gillnets, bottom longlines and vertical setlines operating over, or closely adjacent to, rocky or boulder-strewn seafloors. Trawler captures are likely in various areas (e.g., Sicilian Channel and Adriatic Sea). Anecdotal data from SCUBA divers in Beirut, who have encountered O. ferox at a nearshore reef over more than a decade, suggest an erratic decline in the number of sharks being encountered there despite regular diving at the same site each year. It is unclear if wars in Lebanon, which have some limited local impact on the marine environment (ships wrecked, etc.) are a factor. There has been no evidence of sharks being deliberately harassed or killed locally, other than a small number of incidental captures to artisanal fishermen in neighbouring waters.

In recent years, the discovery of at least one apparent aggregation ground for these sharks in the Mediterranean, off Lebanon (Fergusson et al. 2008) clearly indicates the vulnerability of these large, apparently harmless and rather sluggish sharks to human interference or directed fisheries. A particular concern must be degradation of favoured inshore habitats which may be used for reproduction during the summer months, as suspected with the Lebanese site.

Coastal development for tourism, coupled to uncontrolled spearfishing, unregulated coastal fisheries, pollution and increased human aquatic leisure activities may all seriously impact these sharks whilst inhabiting areas outside their deepwater environment, much as they may account for the contemporary acute decline or even disappearance of the (routinely coastal) sandtiger Carcharias taurus from its previous Mediterranean range (Fergusson et al. 2002).

Australia
Commercial fishing, whereby this species is taken incidentally, on the outer continental shelf and continental slope is a potential threat to its survival in south-eastern Australian waters.

From the available information, O. ferox was never abundant off New South Wales (NSW), but there is strong evidence that numbers seriously declined between 1972 and 1997. Of the 36 specimens caught by the NSW Fisheries Research Vessel Kapala, 33 were caught between 1975 and 1981 (from 500 slope trawl tows), but only three were taken from about 300 trawl tows made between 1982 and 1997 (Fergusson et al. 2008).

Comparable data are available for NSW upper slope trawl surveys in 1976-77 and 1996-97 where gear and sampling protocols were similar (see Graham et al. 1997). Twelve captures (14 sharks) were made during 246 tows in 1976-77, but only a single juvenile was caught during 165 tows made in 1996-97. Although considered in Pogonoski et al. (2002) as Near Threatened, based on available NSW catch data, reassessment to Vulnerable is warranted for Australia.

New Zealand
There has been limited take for aquarium display (e.g. Kelly Tarlton?s Aquarium at Auckland NZ), but the maximum survival in captivity has been 11 months.

South Africa
Small numbers were observed caught on longline gear at about ~300 m along the south KZN coast, South Africa, in the late 1980s, and further anecdotal information indicates relatively frequent capture of these sharks (of approx. 2 m TL) during target fishing for deep-sea sharks and rays (D. Ebert, pers. comm. 2004). Recent evidence of possible sightings of shallow water aggregations off the Transkei coast, South Africa, at depths of 20-30 m suggests that this species may be more vulnerable to fishing pressure than previously assumed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vulnerable (VU) (A2bd+4bd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In place
Because the numbers of C. taurus along the NSW coast had been seriously depleted by indiscriminate spear fishing, and by some commercial harvesting, that species was protected in 1984 (Pollard et al. 1996). To avoid any misidentification or claims of confusion with O. ferox, both species were included on the NSW protected species list.

Despite this legal protection, compliance is difficult to enforce and carcasses of juvenile O. ferox are sometimes marketed simply as ?shark?. However, even if they or larger adults were returned to the sea intact, these sharks are unlikely to survive the trauma of trawl capture from deepwater. In a wider context, as exploitation of deepwater fishery resources increases worldwide, fishing mortality of such species such as O. ferox will increase and may put the survival of the species at risk.

Recommended
The species is presently (2006) being considered for protection in New Zealand (C. Duffy, pers. comm.).

Although the distribution and status of the population in subequatorial Africa is unknown, the apparent rarity and vulnerability of O. ferox means that should any aggregation sites be found, stringent protection would be wise.

At present this species has not been protected from commercial fishing in any subequatorial African country, due to the fact that it has been observed so rarely and no records have been recorded from any commercial vessel.

There are no specific protection measures in place for the Mediterranean, despite its status there. The protection of favoured coastal habitats and more detailed monitoring of catches within Mediterranean fisheries should be priorities. Conservation of frequented sites as a dive tourism attraction could provide an incentive for local protection, as for well-known C. taurus habitats in Australia and South Africa.

This species has been reported by divers at the Cocos-Keeling Islands (Australia) and also other areas such as the Kermadec Islands (New Zealand), the Mediterranean, and Malpelo Island off Columbia. Such community-based dive observations or monitoring may be of use in obtaining information on its biology and knowledge of important habitats in shallow waters.

Further study is needed to accurately determine the distributional range, abundance and biology (including possible migrations, sex ratios, fecundity, etc.) of this species.

Any dead specimens landed by commercial fishing (especially trawling) operations should be retained and delivered to the nearest relevant research organisation, so that more biological information can be obtained.

There is now more evidence that coastal locations are frequented by mature O. ferox on a repetitive seasonal basis, possibly for reproduction. Where identified, these sites deserve stringent protection.

Development of by-catch mitigation measures such as trawl exclusion devices should be undertaken in relevant fisheries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Smalltooth sand tiger

The smalltooth sand tiger or bumpytail ragged-tooth (Odontaspis ferox) is a species of mackerel shark in the family Odontaspididae, with a patchy but worldwide distribution in tropical and warm temperate waters. They usually inhabit deepwater rocky habitats, though they are occasionally encountered in shallow water, and have been known to return to the same location year after year. This rare species is often mistaken for the much more common grey nurse shark (Carcharias taurus), from which it can be distinguished by its first dorsal fin, which is larger than the second and placed further forward. It grows to at least 4.1 m (13.5 ft) in length.

Very little is known of the biology and behavior of the smalltooth sand tiger. It is an active predator of benthic bony fishes, invertebrates, and cartilaginous fishes. This species is thought to be ovoviviparous with oophagous embryos like other mackerel sharks. In contrast to its formidable size and appearance, this shark is harmless, having never been known to behave aggressively towards humans. There is concern that its numbers are declining due to human activities in the Mediterranean and elsewhere, though existing data is inadequate for a full assessment of its conservation status.

Taxonomy and phylogeny[edit]

The smalltooth sand tiger was originally described as Squalus ferox by Italian-French naturalist Antoine Risso in 1810, based on a specimen from Nice, France. In 1950, Gilbert Percy Whitley described O. herbsti from Australian specimens, separating them from O. ferox on the basis of dentition and the absence of spots. Leonard Compagno synonymized the two species in 1984, as subsequently discovered Pacific specimens had blurred Whitley's distinguishing characters.[2] The specific epithet ferox is Latin for "fierce".[3] Other common names for this shark include blue nurse shark, fierce shark, Herbst's nurse shark, and sand tiger shark.[4]

A phylogenetic study based on mitochondrial DNA, performed by Naylor et al. in 1997, suggests that the smalltooth sand tiger and its relative, the bigeye sand tiger (O. noronhai), are more closely related to the thresher sharks than to the grey nurse shark, to which it bears a strong resemblance. If true, this would indicate that the similarities between this species and the grey nurse shark arose as the result of convergent evolution.[5] Fossil teeth belonging to the smalltooth sand tiger have been found from Lower Pliocene (5.3–3.6 Ma) deposits in Italy and Venezuela.[6][7]

Description[edit]

The smalltooth sand tiger has unequal-sized dorsal fins.

The smalltooth sand tiger has a bulky body with a long, bulbous, slightly flattened snout. The eyes are medium-sized, with large round pupils (as opposed to slit-like in the grey nurse shark), and lack nictitating membranes. The mouth is large and filled with projecting teeth. Each tooth has a narrow, tall central cusp flanked by 2-3 pairs of lateral cusplets. There are 48–56 tooth rows in the upper jaw and 36–46 tooth rows in the lower jaw; the front large teeth in the upper jaw are separated from the lateral teeth by 2–5 intermediate teeth.[8]

The fins are broad-based and angular in shape. The first dorsal fin is larger than the second and placed closer to the pectoral fins than the pelvic fins. The caudal fin is strongly asymmetrical with the upper lobe much longer than the lower. The coloration is gray to gray-brown above and lighter below.[8] Juveniles are uniform in color with darker fin margins, while adults often exhibit dark spots or blotches that vary widely in pattern, size, and density. Coloration also appears to vary by region, with some individuals from the Mediterranean displaying a patchy, "piebald" pattern.[2] The smalltooth sand tiger attains a maximum length of 4.1 m (13.5 ft) and a maximum weight of 289 kg (637 lbs).[4] There are unconfirmed reports of much larger individuals from Malpelo Island off Colombia.[8]

Distribution and habitat[edit]

Smalltooth sand tiger in the Flower Garden Banks National Marine Sanctuary, Florida

Smalltooth sand tigers have been caught at widely scattered locations throughout the world, indicating a possibly circumtropical distribution. In the eastern Atlantic Ocean, it is known from the Bay of Biscay south to Morocco, including the Mediterranean Sea, the Azores, and the Canary Islands. In the western Atlantic, it has been reported from off North Carolina and Florida (USA), the Yucatan Peninsula (Mexico), and Fernando de Noronha (Brazil). It occurs throughout the Indian Ocean, from South Africa, Madagascar, and Tanzania in the west to the Maldives and the Southwest Indian Ridge in the east. In the northern Pacific it is known from off Japan, Hawaii, California, and Colombia, and in the southern Pacific it is known from New Caledonia, eastern Australia, and New Zealand.[2]

Typically regarded as a deepwater species, the smalltooth sand tiger has been caught down to a depth of 880 m (2,900 ft). They are usually found near the bottom in rocky, boulder-strewn regions on continental shelves and the upper continental slope, as well as around submarine ridges and mountains. There are also reports of this species near the drop-offs of rocky or coral reefs and in the upper layers of the open ocean. In the Mediterranean, smalltooth sand tigers occur at depths less than 250 m (820 ft), including at depths accessible to divers.[2] They have been seen swimming over sandy flats at Cocos Island and Fernando de Noronha. The temperature range favored by this species is 6–20 °C (43–63 °F); in hot climates they are found below the thermocline in cooler water.[2]

Biology and ecology[edit]

Smalltooth sand tiger at the Northampton Seamount. In the open ocean, this species is strongly associated with submarine ridges and seamounts.

The smalltooth sand tiger is a strong-swimming shark that may be encountered singly or in aggregations of up to five individuals. Catch records suggest that this species may cover long distances in oceanic waters along underwater ridges or "hopping" between seamounts.[2] It has a very large, oily liver, which allows it to maintain neutral buoyancy in the water column with minimal effort.[8] At a location called "Shark Point" off Beirut, Lebanon, small groups of smalltooth sand tigers appear every summer on rocky reefs at a depth of 30–45 m (100–150 ft).[9] The same individuals have been documented returning to this site year after year.[2] Their purpose there is unknown, being speculated to relate to mating. When confronted, these sharks have been observed to stall, gape their mouths, turn around, and shake their tails towards the perceived threat.[8]

Adult smalltooth sand tigers have no known predators, though they are bitten by cookiecutter sharks (Isistius brasiliensis). A known parasite is the tapeworm Lithobothrium gracile, which infests the shark's spiral valve intestine. The carcass of a 3.7 m (12.1 ft) long female found off Fuerteventura in the Canary Islands contained a number of snubnosed eels (Simenchelys parasitica) inside her heart, body cavity, and back muscles. It is unknown whether the eels contributed to the shark's death.[2]

Feeding[edit]

A smalltooth sand tiger at a hydrothermal vent on the Kasuga-2 submarine volcano. Smaller individuals such as this tend to remain in deeper water.

Compared to the grey nurse shark, the dentition of the smalltooth sand tiger is less robust and lacks specialized cutting and crushing teeth, suggesting that it tends to tackle smaller prey.[8] The diet of the smalltooth sand tiger consists of bottom-dwelling bony fishes such as rockfish (Sebastes spp.), invertebrates such as squid, shrimp, and possibly marine isopods, and cartilaginous fishes including rays and chimaeras. The largest known prey item taken by this species was a 1.3 m (4.3 ft) long kitefin shark (Dalatias licha), found inside the stomach of a 2.9 m (9.5 ft) long male from New Caledonia.[2]

Life history[edit]

No pregnant smalltooth sand tigers have ever been found; this species is presumed to be ovoviviparous as in other mackerel sharks. Villaviencio-Garayzar (1996) described a 3.6 m (11.8 ft) female from the Gulf of California that contained "hundreds of ova" in her right ovary, which would support the embryos being oophagous. Whether the embryos also cannibalize each other as in the grey nurse shark is unknown. The size at birth is estimated to be 1.0–1.1 m (3.3–3.6 ft). With a few recorded exceptions, juveniles are found in deep water and only adults are present above a depth of 200 m (660 ft); this may serve to reduce predation on young individuals by large, shallow-water predators such as the great white shark (Carcharodon carcharias). Males mature at a length of 2.0–2.5 m (6.6–8.2 ft) and females at a length of 3.0–3.5 m (9.4–11.5 ft). Faint scars seen on some individuals may be related to courtship.[2][8]

Human interactions[edit]

Encounters with divers have shown that, despite their size, smalltooth sand tigers are docile and do not react aggressively even when closely approached.[8] This species is taken as bycatch in gillnets, bottom trawls, and on longlines; most captures occur in the Mediterranean and off Japan. It is usually discarded when caught, except in Japan where the meat is consumed (though considered very inferior to the grey nurse shark) and the liver oil is utilized.[8] The fins, jaws, and cartilage are also of value.[4]

Discoveries, beginning in the 1970s, of smalltooth sand tigers in shallow water have raised urgent conservation concerns, as this species is apparently more vulnerable to human activity than previously believed. There is at present insufficient data for the International Union for Conservation of Nature (IUCN) to assess the worldwide conservation status of this species. It has been assessed as Vulnerable in Australian waters, due to a decline of over 50% in catches off New South Wales since the 1970s. Populations of this species in the Mediterranean are also believed to have declined, due to a combination of habitat degradation, overfishing, pollution, and human disturbance.[1] The smalltooth sand tiger has been protected by the Australian government since 1984; this came about concurrently with protection for the grey nurse shark, which had been decimated in Australian waters, so as to prevent any claims of confusing one species for the other. However, these regulations have proven difficult to enforce.[2]

References[edit]

  1. ^ a b "Odontaspis ferox". IUCN Red List of Threatened Species. Version 2007. International Union for Conservation of Nature. 2003. Retrieved April 25, 2009. 
  2. ^ a b c d e f g h i j k Fergusson, I. K., Graham, K. J., and Compagno, L. J. V. (2008). "Distribution, abundance and biology of the smalltooth sandtiger shark Odontaspis ferox (Risso, 1810) (Lamniformes: Odontaspididae)". Environmental Biology of Fishes 81 (2): 207–228. doi:10.1007/s10641-007-9193-x. 
  3. ^ Ebert, D. A. (2003). Sharks, Rays, and Chimaeras of California. London: University of California Press. pp. 93–95. ISBN 0-520-23484-7. 
  4. ^ a b c Froese, Rainer and Pauly, Daniel, eds. (2009). "Odontaspis ferox" in FishBase. April 2009 version.
  5. ^ Naylor, G. J. P., Martin, A. P., Mattison, E. G., and Brown, W. M. (1997). "Interrelationships of lamniform sharks: testing phylogenetic hypotheses with sequence data". In Kocher, T. D., and Stepien, C. A. Molecular Systematics of Fishes. San Diego: Academic Press. pp. 199–218. ISBN 0-12-417540-6. 
  6. ^ Cappetta, H. (1987). "Chondrichthyes II. Mesozoic and Cenozoic Elasmobranchii". Handbook of Paleoichthyologie (Volume 3B). Stuttgart: Gustav Fischer Verleg. pp. 85–110. 
  7. ^ Aguilera, O., and Aguilera, D. R. (2001). "An exceptional coastal upwelling fish assemblage in the Caribbean Neogene". Journal of Paleontology 75 (3): 732–742. doi:10.1666/0022-3360(2001)075<0732:AECUFA>2.0.CO;2. 
  8. ^ a b c d e f g h i Compagno, L. J. V. (2002). Sharks of the World: An Annotated and Illustrated Catalogue of Shark Species Known to Date (Volume 2). Rome: Food and Agricultural Organization. pp. 64–66. ISBN 92-5-104543-7. 
  9. ^ Martin, R. A. Biology of the Bumpytail Ragged-Tooth Shark (Odontaspis ferox). ReefQuest Centre for Shark Research. Retrieved on April 25, 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!