Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Biology

The sharptooth lemon shark is reportedly a sluggish shark that swims slowly near the bottom, frequently resting on the substrate. This shy shark is generally reluctant to approach divers, even when food is used to lure them near. Young sharks are said to be more inquisitive, and a shark of any age is likely to respond to being provoked by humans, or approached by boats, with aggression. The majority of the sharptooth lemon shark's diet consists of bottom-dwelling bony fishes and stingrays (3). This is a viviparous shark, thus the embryos develop inside, and receive nutrition from, the mother for about ten months. Litters can vary from 1 to 13 young, with each pup measuring about 45 centimetres (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This big, stocky shark looks almost identical to the lemon shark (Negaprion brevirostris), but can be distinguished by the rear edge of the pectoral fins, which are slightly more curved, or sickle-shaped. The sharptooth lemon shark has pale yellow-brown skin, a broad, blunt snout, and the second dorsal fin is almost at large as the first (3) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Found on continental and insular shelves and terraces (Ref. 244). Common on coral reefs (Ref. 5578) and in shallow, sandy lagoons and turbid, mangrove swamps (Ref. 6871). Feeds on smaller sharks, stingrays and on benthic bony fishes (Ref. 5578). Viviparous (Ref. 50449). Dangerous if provoked (Ref. 244). 1 to 11 of 45 cm young are born per litter (Ref. 1602). Meat is utilized fresh and dried salted for human consumption, fins for shark-fin soup base, and liver oil for vitamins (Ref. 244).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Wide ranging in the Indian Ocean and western Central Pacific, extending from South Africa to the Australian region and Oceania (Compagno and Niem 1998). Within Australia, from Moreton Bay (Queensland) to the Abrolhos Islands (Western Australia) (Last and Stevens 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Red Sea and South Africa (including Mauritius, Seychelles, Madagascar) to Philippines, north to Viet Nam, south to Australia. Also from Palau, Marshall Islands, and Tahiti. Recorded from Taiwan (Ref. 4868).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Seychelles, Madagascar and Mauritius (Mascarenes) east to Marshall Islands and Society Islands, north to Ryukyu Islands, south to Queensland (Australia) and New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Occurs in the tropical Indian Ocean and the west and central Pacific (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 3800 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

380 cm TL (male/unsexed; (Ref. 5213))
  • Fischer, W., I. Sousa, C. Silva, A. de Freitas, J.M. Poutiers, W. Schneider, T.C. Borges, J.P. Feral and A. Massinga 1990 Fichas FAO de identificaçao de espécies para actividades de pesca. Guia de campo das espécies comerciais marinhas e de águas salobras de Moçambique. Publicaçao preparada em collaboraçao com o Instituto de Investigaçao Pesquiera de Moçambique, com financiamento do Projecto PNUD/FAO MOZ/86/030 e de NORAD. Roma, FAO. 1990. 424 p. (Ref. 5213)   http://www.fishbase.org/references/FBRefSummary.php?id=5213&speccode=151 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Slow swimming shark that inhabits lagoons and seaward reefs but prefers turbid waters of inshore lagoons, often over sandy substrate at depths under 30 m (Ref. 1602). Feeds on bottom-dwelling fishes and rays. Preys on smaller sharks, including porcupine fishes, and stingrays. Viviparous; 1-13 per litter; 45-80 cm at birth. Dangerous if provoked. Meat is utilized fresh and dried salted for human consumption, fins for shrk-fin soup base, and liver oil for vitamins.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

A large, stocky, yellowish shark with a broad, blunt snout, narrow, smooth-cusped teeth in both jaws, and equal-sized dorsal fins (Ref. 5578). Yellowish brown above, paler below (Ref. 9997). With two nearly equally large dorsal fins (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Negaprion acutidens
Catalog Number: USNM 152917
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): Applied Fisheries Laboratory, University of Washington
Year Collected: 1946
Locality: Bikini: Reer Island, Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
  • Type: Schultz, L. P. & Welander, A. D. 1953. Bulletin of the United States National Museum. No. 202: 9, figs. 5a-f; pl. 1.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Gestation period: 10 to 11 months
Reproductive periodicity: two years
Size at birth: 60 cm total length (TL)
Average litter size: 9.3 (6 to 12)
Size male maturity: 220 cm TL
Size female maturity: 220 cm TL
Max size: 300 cm TL
Growth rates, Juveniles: 12.5 to 15.5 cm/yr

Occurs in tropical, shallow inshore and offshore waters near the bottom; often found on and around coral reefs and on sandy plateaus near coral, at depths down to at least 30 m (Compagno and Niem 1998). Often found inside coral lagoons but also on reef flats and reef edges (Stevens 1984). It is also known to occur around and within mangrove estuaries (W. White pers.comm.).

Out of 143 animals tagged at 43 sites by Stevens (1984), 19 individuals were recaptured (14.5%) of which five were caught more than once. These data showed that 52% of recoveries were made at the tagging site, 83% within 1 km of tagging site and 91% within 2 km. The average distance moved by individuals was 1.3 km (excluding those animals that did not move from tagging site) and the maximum distance traveled was 5 km.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; brackish; marine; depth range 0 - 92 m (Ref. 244)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 5 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 19 - 56

Graphical representation

Depth range (m): 19 - 56
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 92m.
Recorded at 92 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The sharptooth lemon shark occurs in tropical waters over continental shelves, down to depths of 30 meters. It seems to prefer bays, estuaries, sandy plateaus, reef shelves and reef lagoons, often in still, turbid water. Young sharks are frequently found on reef flats, where water is shallow enough to expose their dorsal fins (3) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs on the continental shelf (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Viviparous, placental (Ref. 50449), 1-14 per litter (Ref. 6871). Gestation period 10-11 months (Ref. 5578; Ref.58048). Size at birth about 50 to 70 cm TL (Ref. 9997); 45-80 cm TL (Ref.58048). Distinct pairing with embrace (Ref. 205). Mating and pupping take place during late spring and early summer (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Negaprion acutidens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 29
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Negaprion acutidens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTGATTTTTGGTGCATGAGCAGGTATAGTTGGAACAGCCCTTAGCCTTCTAATTCGGGCTGAACTTGGTCAACCTGGATCACTTTTAGGGGATGATCAAATTTATAATGTAATCGTAACTGCCCATGCTTTCGTAATAATCTTCTTTATAGTTATACCAATCATGATTGGTGGTTTCGGGAACTGACTAGTTCCATTAATAATTGGTGCGCCAGATATAGCCTTCCCACGAATAAATAACATAAGTTTCTGACTTCTTCCACCATCATTCCTTCTTCTCCTCGCCTCTGCTGGAGTAGAGGCTGGGGCAGGAACTGGTTGAACAGTCTATCCTCCATTAGCTAGTAACCTAGCCCATGCTGGGCCATCTGTTGATTTAGCTATCTTCTCTCTCCACTTAGCTGGTGTTTCATCAATTTTAGCTTCAATTAACTTCATTACAACTATTATTAATATAAAACCACCAGCTATTTCCCAATATCAAACACCATTATTTGTTTGATCAATTCTTGTAACTACTATTCTTCTTCTCCTTTCACTTCCAGTTCTCGCAGCAGGAATTACGATATTACTTACAGATCGCAACCTTAATACTACATTCTTTGATCCTGCAGGTGGAGGAGATCCAATCCTTTATCANNNNNNNNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2abcd+3bcd+4abcd

Version
3.1

Year Assessed
2003

Assessor/s
Pillans, R. (SSG Australia & Oceania Regional Workshop, March 2003)

Reviewer/s
Cavanagh, R.D., Kyne, P.M., McAuley, R. & White, W.T. (Shark Red List Authority)

Contributor/s

Justification
A widely distributed tropical Indo-west and central Pacific inshore species usually associated with coral reefs, lagoons and mangrove estuaries, and which exhibits very limited movement patterns. Within Australian waters, this species is wide-ranging and captured in small numbers in gillnets, beachmeshing and longlines on the east coast and Northern Territory. Catches in Western Australia are also small. In Australia, there are likely to be significant areas of unfished habitat outside the operational ranges of these fisheries, thus the population is assessed as Least Concern. Outside Australia, this species is heavily fished in unregulated and expanding inshore fisheries throughout its range, and this, together with its narrow habitat range and limited potential for recolonisation of heavily fished sites, leads to a global assessment of Vulnerable. Further, in Indonesia there has been little recent evidence of this species at fish markets although it was historically abundant. Widespread damage and destruction of coral reefs and mangrove habitats in parts of South East Asia are also cause for concern. In addition there are records of local extinctions in India and Thailand. This species is assessed as Endangered in South East Asia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List (1). The Southeast Asia subpopulation is classified as Endangered (EN) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Within Australia, data from the Northern Territory (Lyle et.al. 1984) indicated that catch rates of N. acutidens in gill net and long line fishing trials were very low. N. acutidens is taken in small quantities (approximately 15 tonnes/yr) in the Western Australia northern shark fisheries. These fisheries comprise a very small number of boats (13 licenses, seven active and only three fishing for six months or more) operating over a very large length of coast. A smaller quantity of N. acutidens are also taken as bycatch in trawl and gillnet fisheries in northern Western Australia waters. There are likely to be significant areas of unfished habitat outside the operational ranges of these fisheries (R. McAuley, pers.comm).

Threats from inshore fisheries are high outside Australian waters, particularly Southeast Asia, where these sharks are captured by gillnets and longlines. They are particularly susceptible to local depletion due their very small habitat range and limited movement patterns (Stevens 1984). This species is also likely to be affected by habitat destruction, particularly in South East Asia. For example, extensive coral reef habitat destruction (pollution and dynamite fishing), in addition, this species is known to occur around and within mangrove estuaries, many of which have been deforested or are heavily populated by humans throughout its range (William White, pers.comm.).

Although they are still recorded, albeit very infrequently within Indonesia (W. White, pers. comm.), evidence suggests N. acutidens was historically more abundant, and have not been seen for several years in some areas. For example, in a preliminary survey of market catches around Bali, no N. acutidens were recorded, and jaws held in the fisheries centre in Jakarta that were several years old were the only evidence that this species was once caught in the region (W. White, pers. comm.). Furthermore, evidence of local extinctions in India and Thailand (L.J.V. Compagno, pers. comm.) indicates that this species is extremely susceptible to local inshore fisheries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vulnerable (VU) (A2abcd+3bcd+4abcd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The sharptooth lemon shark is known to be caught in several countries, including India and Thailand, for its meat, vitamin rich liver oil, and fins for shark-fin soup (3). It is thought to be vulnerable to over-fishing due to its restricted habitat preferences and small home range. Evidence of local extinctions in India and Thailand confirms this fear. Its preference for inshore habitats also makes this shark susceptible to the threat of habitat degradation; coral reefs are being destroyed by dynamite fishing and pollution, and mangroves are threatened by human development (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are currently no conservation measures in place for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

At present, there are no known conservation measures in place aimed specifically at the sharptooth lemon shark.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sicklefin lemon shark

The sicklefin lemon shark, or sharptooth lemon shark (Negaprion acutidens), is a species of requiem shark, belonging to the family Carcharhinidae, widely distributed in the tropical waters of the Indo-Pacific. It is closely related to the better-known lemon shark (N. brevirostris) of the Americas; the two species are almost identical in appearance, both being stout-bodied sharks with broad heads, two dorsal fins of nearly equal size, and a plain yellow-tinged coloration. As its common name suggests, the sicklefin lemon shark differs from its American counterpart in having more falcate (sickle-shaped) fins. This large species grows up to 3.8 m (12 ft) long. It generally inhabits water less than 92 m (302 ft) deep in a variety of habitats, from mangrove estuaries to coral reefs.

A slow-moving predator feeding mainly on bony fishes, the sicklefin lemon shark seldom travels long distances and many individuals can be found year-round at certain locations. Like other members of its family, this species is viviparous with females giving birth to no more than 13 pups every other year, following a gestation period of 10–11 months. Although they are potentially dangerous to humans and known to respond vigorously to any provocation, under normal circumstances sicklefin lemon sharks are cautious and tend to retreat if approached. The International Union for Conservation of Nature (IUCN) has assessed this species as Vulnerable; its low reproductive productivity and rate of movement limits the capacity of depleted stocks to recover. Off India and Southeast Asia, this species has been severely depleted or extirpated by unregulated exploitation for its meat, fins, and liver oil.

Taxonomy and phylogeny[edit]

The sicklefin lemon shark was first described as Carcharias acutidens by German naturalist Eduard Rüppell, in the 1837 Fische des Rothen Meeres (Fishes of the Red Sea). In 1940, Australian ichthyologist Gilbert Percy Whitley moved this species to his newly formed genus Negaprion. The type specimen, designated in 1960, is a 68 cm (27 in) long individual caught in the Red Sea off Jeddah, Saudi Arabia.[2] The specific epithet acutidens is derived from the Latin acutus meaning "sharp", and dens meaning "teeth". The sicklefin lemon shark may also be referred to as broadfin shark, Indian lemon shark, Indo-Pacific lemon shark, or simply lemon shark.[3]

Based on microsatellite DNA evidence, the sicklefin lemon shark is thought to have diverged from its sister species N. brevirostris 10–14 million years ago, when the closure of the Tethys Sea separated lemon sharks in the Indian Ocean from those in the Atlantic.[4] The ancestral lemon shark species may have been N. eurybathrodon, whose fossilized teeth occur in both the United States and Pakistan.[4] Morphological and molecular phylogenetic analyses suggest that Negaprion is grouped with the whitetip reef shark (Triaenodon) and the sliteye shark (Loxodon) in occupying an intermediate position on the carcharhinid evolutionary tree, between the most basal genera (Galeocerdo, Rhizoprionodon, and Scoliodon) and the most derived (Carcharhinus and Sphyrna).[5]

Distribution and habitat[edit]

a large shark with sickle-shaped pectoral fins and two dorsal fins of nearly equal size, swimming just over a coral reef
Coral reefs are one of the environments inhabited by the sicklefin lemon shark.

The range of the sicklefin lemon shark extends from South Africa to the Red Sea (including Mauritius, the Seychelles, and Madagascar), continuing eastward along the coast of the Indian subcontinent to Southeast Asia, extending as far north as Taiwan and the Philippines, and as far south as New Guinea and northern Australia. This species is also found around numerous Pacific islands, including New Caledonia, Palau, the Marshall Islands, the Solomon Islands, Fiji, Vanuatu, and French Polynesia.[1][2] This species likely colonized the central Pacific by infrequently "hopping" from one island to the next. Significant levels of genetic differentiation between sicklefin lemon sharks in Australia and French Polynesia, 750 km (470 mi) apart, suggest that there is little intermingling between regional subpopulations.[4]

An inhabitant of coastal continental and insular shelves, the sicklefin lemon shark occurs from the intertidal zone to a depth of 92 m (302 ft).[6] This species favors still, murky waters and is most common in bays, estuaries, and lagoons, and over sandy flats and outer reefs. Sometimes an individual may venture into open water; one was filmed in the 1971 documentary Blue Water, White Death, in the vicinity of a sperm whale (Physeter macrocephalus) carcass. Juvenile sicklefin lemon sharks are often found on reef flats or around mangroves, in water so shallow that their dorsal fins are exposed.[2][7] In Herald Bight off Western Australia, a known nursery, juvenile sicklefin lemon sharks frequent open areas and mangroves in water under 3 m (9.8 ft) deep, but not areas covered by the seagrass Posidonia australis.[8]

Description[edit]

A sicklefin lemon shark over a coral reef, surrounded by smaller, colorful butterfly fish
Sickle-shaped fins are a distinguishing characteristic of this species.

The sicklefin lemon shark has a robust, stocky body and a short, broad head. The snout is rounded or almost wedge-shaped, with small nostrils bearing triangular flaps of skin in front. The eyes are small, and there are no spiracles. Short furrows are present at the corners of the mouth.[2] There are 13–16 (usually 14) tooth rows on either side of both jaws, not including the tiny teeth at the symphysis (the jaw midline). The upper teeth have a large cusp rising from a broad base, with a notch on each side; these teeth become increasingly angled towards the corners of the mouth. The lower teeth resemble the upper teeth but are narrower and more erect.[7] The teeth of sharks over 1.4 m (4.6 ft) long are finely serrated.[2]

The fins (especially the dorsal, pectoral, and pelvics) of the sicklefin lemon shark are more falcate (sickle-shaped) than those of the otherwise very similar American lemon shark. The first dorsal fin is positioned closer to the pelvic than the pectoral fins. The second dorsal fin, nearly equal to the first in size, is located over or slightly forward of the anal fin. There is no ridge between the dorsal fins. The pectoral fins are long and broad, originating below the space between the third and fourth gill slits. The anal fin has a strong notch in the rear margin. The precaudal pit (a cavity just forward of the caudal fin) is oriented longitudinally.[2] The large dermal denticles are overlapping and bear 3–5 horizontal ridges each.[6] The coloration is a plain yellowish brown or gray above and lighter below, with more yellow on the fins.[9] This species attains a maximum known length of 3.8 m (12 ft),[3] though it typically does not exceed 3.1 m (10 ft).[7]

Biology and ecology[edit]

A sicklefin lemon shark swimming closely over a patch of sand
The sicklefin lemon shark usually swims close to the bottom.
Courtship behaviour: a male (right) follows a female.

A sluggish species, the sicklefin lemon shark is usually seen cruising sedately just above the sea bottom or lying still on it, as unlike most requiem sharks it is capable of actively pumping water over its gills. However, it will approach the surface in pursuit of food.[2] This shark seldom undertakes long-distance movements.[4] A study at Aldabra Atoll in the Seychelles found that, of the tagged sharks that were later recaptured, over 90% were still within 2 km (1.2 mi) of their initial tagging location.[10] Another study at Moorea in French Polynesia found that some of the local sharks were year-round residents of the island, while others were more transitory and visited only occasionally.[11]

Over 90% of the sicklefin lemon shark's diet consists of bottom and shore-dwelling teleosts, including herring, mullets, mackerel, silversides, needlefish, smelt-whitings, porgies, sea catfish, triggerfish, parrotfish, and porcupinefish. Occasionally they may also take cephalopods and crustaceans, and older individuals have been known to consume stingrays and guitarfish.[2][10][12][13] This species may be preyed upon by larger sharks.[6] Known parasites include the tapeworms Paraorygmatobothrium arnoldi,[14] Pseudogrillotia spratti,[15] Phoreiobothrium perilocrocodilus,[16] and Platybothrium jondoeorum.[17] Sicklefin lemon sharks have been documented resting on the bottom and eliciting cleanings by bluestreak cleaner wrasses (Labroides dimidiatus), during which they may open their mouths and stop respiring for as long as 150 seconds to give the wrasses access to their mouths and gills.[18]

As with other members of its family, the sicklefin lemon shark is viviparous, meaning the developing embryos are sustained by a placental connection formed from their depleted yolk sacs. Females give birth to 1–13 (usually 6–12) pups every other year in shallow nursery areas, following a gestation period of 10–11 months.[2][10] Unlike in the American lemon shark, there is scant evidence that this species is philopatric (returning to the site of their birth to reproduce).[4] Parturition occurs in October or November at Madagascar and Aldabra, and in January at French Polynesia; ovulation and mating for non-pregnant females takes place at around the same time. The embryos develop a placenta after around four months of gestation, when they still possess vestiges of external gills. The young are born at a length of 45–80 cm (18–31 in).[2][10] Juvenile sharks grow slowly, at a rate of 12.5–15.5 cm (4.9–6.1 in) per year. Both sexes attain sexual maturity at a length of 2.2–2.4 m (7.2–7.9 ft).[6]

Human interactions[edit]

View from above of a sicklefin lemon shark hooked on a line, its head being pulled just above the water surface
The sicklefin lemon shark is threatened by overfishing.

Several apparently unprovoked attacks on humans have been attributed to the sicklefin lemon shark. Due to its formidable size and teeth it is regarded as potentially dangerous, and certainly this species has been known to defend itself quickly and vigorously if touched, speared, or otherwise provoked or alarmed. Once agitated this shark can be a persistent adversary: in one case, a shark forced a swimmer to seek refuge atop a coral head, and circled for hours before giving up. However, observations by divers show that normally this shark is shy and hesitant to approach, even when presented with bait. Often, the shark will move away when a diver enters visual range. Young sharks are reportedly more aggressive and inquisitive than the adults.[2] At Moorea, sicklefin lemon sharks are the main attraction of daily shark-feeding ecotourism dives.[11] This shark adapts well to captivity and is displayed in public aquariums.[2]

The International Union for Conservation of Nature (IUCN) has assessed the sicklefin lemon shark globally as Vulnerable; it is harvested using anchored and floating gillnets, beach nets, and longlines.[1] The meat is sold fresh or dried and salted for human consumption, the fins used for shark fin soup, and the liver oil processed for vitamins.[2] The sicklefin lemon shark is highly susceptible to local overfishing, due to its slow reproductive rate and limited movements. Off Southeast Asia, this shark has become scarce under the pressure of expanding, unmonitored, and unregulated fisheries, and has been assessed there as Endangered by the IUCN. Widespread habitat degradation, including pollution and blast fishing on coral reefs and deforestation in mangroves, poses an additional threat to the survival of this species in the region. Already, the sicklefin lemon shark has been made extinct in parts of India and Thailand, and has not been reported from Indonesian markets in recent years despite being historically abundant there. Off Australia, the sicklefin lemon shark is taken in only small numbers intentionally and as bycatch, and has been listed under Least Concern.[1]

References[edit]

  1. ^ a b c d Pillans, R. (2003). Negaprion acutidens. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved May 4, 2009.
  2. ^ a b c d e f g h i j k l m Compagno, L.J.V. (1984). Sharks of the World: An Annotated and Illustrated Catalogue of Shark Species Known to Date. Rome: Food and Agricultural Organization. pp. 517–518. ISBN 92-5-101384-5. 
  3. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2009). "Negaprion acutidens" in FishBase. August 2009 version.
  4. ^ a b c d e Schultz, J.K., K.A. Feldheim, S.H. Gruber, M.V. Ashley, T.M. McGovern and B.W. Bowen (2008). "Global phylogeography and seascape genetics of the lemon sharks (genus Negaprion)". Molecular Ecology 17 (24): 5336–5348. doi:10.1111/j.1365-294X.2008.04000.x. PMID 19121001. 
  5. ^ Carrier, J.C., J.A. Musick and M.R. Heithaus (2004). Biology of Sharks and Their Relatives. CRC Press. pp. 52, 502. ISBN 0-8493-1514-X. 
  6. ^ a b c d Bester, C. Biological Profiles: Sicklefin Lemon Shark. Florida Museum of Natural History Ichthyology Department. Retrieved on August 24, 2009.
  7. ^ a b c Randall, J.E. and J.P. Hoover (1995). Coastal Fishes of Oman. University of Hawaii Press. p. 35. ISBN 0-8248-1808-3. 
  8. ^ White, W.T. and I.C. Potter (2004). "Habitat partitioning among four elasmobranch species in nearshore, shallow waters of a subtropical embayment in Western Australia". Marine Biology 145 (5): 1023–1032. doi:10.1007/s00227-004-1386-7. 
  9. ^ Randall, J.E., G.R. Allen, and R.C. Steene (1997). Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press. p. 22. ISBN 0-8248-1895-4. 
  10. ^ a b c d Stevens, J.D. (July 23, 1984). "Life-History and Ecology of Sharks at Aldabra Atoll, Indian Ocean". Proceedings of the Royal Society B 222 (1226): 79–106. doi:10.1098/rspb.1984.0050. 
  11. ^ a b Buray, N., J. Mourier, E. Clua and S. Planes. (2009). "Population size, residence patterns and reproduction of a sicklefin lemon shark population (Negaprion acutidens) visiting a shark-feeding location at Moorea Island, French Polynesia." The 11th Pacific Science Inter-Congress in conjunction with the 2nd Symposium on French Research in the Pacific. March 2–9, 2009.
  12. ^ White, W.T., M.E. Platell and I.C. Potter (2004). "Comparisons between the diets of four abundant species of elasmobranchs in a subtropical embayment: implications for resource partitioning". Marine Biology 144 (3): 439–448. doi:10.1007/s00227-003-1218-1. 
  13. ^ Salini, J.P., S.J.M. Blaber and D.T. Brewer (1990). "Diets of piscivorous fishes in a tropical Australian estuary, with special reference to predation on penaeid prawns". Marine Biology 105 (3): 363–374. doi:10.1007/BF01316307. 
  14. ^ Ruhnke, T.R. and V.A. Thompson (2006). "Two New Species of Paraorygmatobothrium (Tetraphyllidea: Phyllobothriidae) from the Lemon Sharks Negaprion brevirostris and Negaprion acutidens (Carcharhiniformes: Carcharhinidae)". Comparative Parasitology 73 (1): 35–41. doi:10.1654/4198.1. 
  15. ^ Beveridge, I. and J.L. Justine (2007). "Paragrillotia apecteta n. sp. and redescription of P. spratti (Campbell & Beveridge, 1993) n. comb. (Cestoda, Trypanorhyncha) from hexanchid and carcharhinid sharks off New Caledonia". Zoosystema 29 (2): 381–391. 
  16. ^ Caira, J.N., C. Richmond and J. Swanson (2005). "A revision of Phoreiobothrium (Tetraphyllidea: Onchobothriidae) with descriptions of five new species". Journal of Parasitology 91 (5): 1153–1174. doi:10.1645/GE-3459.1. PMID 16419764. 
  17. ^ Healy, C.J. (October 2003). "A revision of Platybothrium Linton, 1890 (Tetraphyllidea: Onchobothriidae), with a phylogenetic analysis and comments on host-parasite associations". Systematic Parasitology 56 (2): 85–139. doi:10.1023/A:1026135528505. PMID 14574090. 
  18. ^ Keyes, R.S. (1982). "Sharks: an unusual example of cleaning symbiosis". Copeia 1982 (1): 227–229. doi:10.2307/1444305. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!