Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Comprehensive Description

Biology

Occurs usually over mud and sandy mud bottoms in coastal waters and in estuaries where the nursery and feeding grounds are located. Feeds mainly on worms, crustaceans and fishes. An excellent foodfish. Sold fresh and frozen; eaten fried, broiled, microwaved and baked (Ref. 9988).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Massachusetts, USA (excluding Florida) and northern Gulf of Mexico to northern Mexico. Possibly from southern Brazil to Argentina. Uncertain in southern Gulf of Mexico, Lesser Antilles and southern Caribbean (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

American species, found for the first time in Belgian (and even European) waters in the night of 16 to 17 August 1998, a second time in 2001 in the Zeeschelde
  • Rappé, G. (2002). Eerste vangst van Micropogonias undulatus (Linnaeus, 1766), een Amerikaanse vis, in Belgische en Europese wateren [First catch of Micropogonias undulatus (Linnaeus, 1766), an American fish, in Belgian and European waters]. De Strandvlo 22(3-4): 119-121   http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1093 External link.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: from 42.35°N to Massachusetts, USA (excluding Florida) and northern Gulf of Mexico to northern Mexico; possibly from southern Brazil to Argentina. Uncertain in southern Gulf of Mexico, Lesser Antilles and southern Caribbean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Belgian Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, North West Atlantic, Schelde estuary, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Atlantic coast from Massachusetts to Florida, and northern Gulf of Mexico to Mexico. Also possibly from southern Brazil to Argentina (Robins and Ray 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

55.0 cm TL (male/unsexed; (Ref. 40637)); max. published weight: 2,580 g (Ref. 40637); max. reported age: 5 years (Ref. 12193)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 67 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth: 0 - 100m.
Recorded at 100 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; brackish; marine; depth range ? - 100 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurs usually over mud and sandy mud bottoms in coastal waters and in estuaries where the nursery and feeding grounds are located.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2437 specimens in 1 taxon.
Water temperature and chemistry ranges based on 745 samples.

Environmental ranges
  Depth range (m): 0 - 273
  Temperature range (°C): 6.832 - 25.997
  Nitrate (umol/L): 0.286 - 18.243
  Salinity (PPS): 32.865 - 36.329
  Oxygen (ml/l): 3.453 - 6.359
  Phosphate (umol/l): 0.093 - 1.177
  Silicate (umol/l): 0.756 - 11.723

Graphical representation

Depth range (m): 0 - 273

Temperature range (°C): 6.832 - 25.997

Nitrate (umol/L): 0.286 - 18.243

Salinity (PPS): 32.865 - 36.329

Oxygen (ml/l): 3.453 - 6.359

Phosphate (umol/l): 0.093 - 1.177

Silicate (umol/l): 0.756 - 11.723
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Coastal waters and estuaries. Demersal species preferring sand or mud bottoms. Know to enter fresh water. Juveniles more restricted to estuaries. Spawns offshore; eggs are pelagic (Manooch 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Alien species

The Atlantic croaker or hardhead Micropogonias undulatus was previously only found along the east coast of the American continent, where it is one of the most common benthic fish. With its benthic lifestyle it is very unlikely that the species crossed the Atlantic Ocean by itself. Thus,via transport in ballast water of ships could be the origin of an introduction in Europe. Since 1998, the Atlantic croaker is found in low numbers in both Belgium and The Netherlands.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Moves offshore to spawn (Lee et al. 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Schools search flats and bars for food on incoming tide; eats mainly benthic crustaceans and polychaetes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

May undergo large yearly fluctuations in population size (Lee et al. 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Spawns over prolonged period from late August off Chesapeake Bay to March off Cape Canaveral; peak spawning months in southeastern U.S. are September-November; sexually mature in 2 years (Manooch 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Micropogonias undulatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTGATTTTTGGTGCATGAGCCGGAATAATCGGCACAGCTTTAAGCCTACTAATTCGAGCCGAACTTAGCCAACCTGGCGCACTCCTCGGAGACGACCAAATTTATAACGTAATCGTTACGGCACATGCCTTCGTCATAATTTTCTTTATAGTAATGCCCATTATGATTGGAGGCTTTGGAAACTGACTTGTACCCCTAATGATTGGGGCCCCTGACATAGCATTCCCCCGAATAAATAATATGAGCTTCTGACTCCTCCCCCCTTCTTTCCTGCTGCTCCTAACCTCCTCAGGGGTAGAAGCAGGTGCCGGAACGGGCTGAACAGTCTATCCCCCACTCGCCGGAAATCTTGCACACGCAGGGGCCTCTGTCGACTTGGCCATTTTTTCCCTTCATCTCGCAGGTGTATCATCAATTTTAGGGGCTATTAACTTCATCACAACAATTATTAACATGAAACCCCCAGCCATCTCCCAATATCAGACACCCCTATTTGTATGAGCCGTTTTAATTACAGCTGTACTACTTCTGCTCTCACTCCCTGTCCTAGCTGCCGGCATTACGATACTTCTAACAGACCGCAACCTTAATACAACCTTTTTTGACCCAGCAGGAGGAGGAGACCCAATYCTTTACCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Micropogonias undulatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 23
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Atlantic croaker

Atlantic croaker in Pass Christian, Mississippi

Atlantic croaker (Micropogonias undulatus) belongs to the family Sciaenidae and is closely related to black drum (Pogonias cromis), silver perch (Bairdiella chrysoura), spot croaker (Leiostomus xanthurus), red drum (Sciaenops ocellatus), spotted seatrout (Cynoscion nebulosus), and weakfish (Cynoscion regalis). They are commonly found in sounds and estuaries from Massachusetts to the Gulf of Mexico. The names croaker and drum are descriptive of the noise the fish makes by vibrating strong muscles against its swim bladder, which acts as a resonating chamber, much like a drum. During spawning season (August to December), croakers turn a deep golden color, from this comes the name golden croaker. When full-grown (three to four years), croakers reach between 1-1/2 feet long and 4-5 pounds, but on average are 1/2-2 pounds. They have been used for food by Native Americans, and are found in shell middens. [1]

Management

Croaker populations greatly vary year to year, and can be dependent on the conditions of their habitats. Their management is challenging due to the variability year to year.


References

  • Robins, C. Richard, G. Carleton Ray, and John Douglass. A Field Guide to Atlantic Coast Fishes-North America. Houghton Mifflin Company. New York. 1986. 184-188.
  • Froese, Rainer, and Daniel Pauly, eds. (2007). "Micropogonias undulatus" in FishBase. Mar 2007 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The only other member of this genus in the western Atlantic is M. FURNERI, a Caribbean and South American species (Lee et al. 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!