Articles on this page are available in 1 other language: Spanish (11) (learn more)

Overview

Comprehensive Description

Biology

Inhabits pools, backwaters and main channels of small to large rivers. Also occurs in lakes and impoundments. Feeds on shellfish and algae, by grinding with the bony plates in its throat (Ref. 9988). Appears to be a good candidate for aquaculture. Marketed fresh and eaten pan-fried, broiled and baked (Ref. 9988).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Lake Michigan drainage and Mississippi River basin from Pennsylvania and Michigan to Montana and south to Gulf; Gulf Slope drainages from Mobile Bay, Alabama, to Rio Grande, Texas and New Mexico; also in Mexico; introduced in Arizona impoundments; common (Page and Burr 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America: Lake Michigan drainage and Mississippi River basin from Pennsylvania and Michigan to Montana, USA and south to the Gulf of Mexico; Gulf Slope drainages from Mobile Bay in Alabama to Rio Grande in Texas and New Mexico, USA. Also in Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 78 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 900 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

112 cm TL (male/unsexed; (Ref. 40637)); max. published weight: 37.3 kg (Ref. 40637); max. reported age: 15 years (Ref. 12193)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Pools, oxbow lakes, and deeper waters of large rivers; sometimes in backwaters and mouths of smaller rivers; reservoirs and lakes. Prefers clean to moderately turbid, deep, warm waters (Sublette et al. 1990). In Texas, habitats with abundant aquatic vegetation and silt bottom were most productive (see Sublette et al. 1990). Spawns in quiet pools, backwaters, flooded marshes and meadows. Eggs sink and adhere to objects.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

May sometimes migrate up small streams to spawn (Becker 1983)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Feeds opportunistically on benthic organisms, animal and plant (Becker 1983). Major foods of young include cladocerans, copepods, and algae; adults eats various insects, crustaceans, mollusks, other invertebrates, algae, and plant material. Feeds primarily in shallow shoreline areas in reservoirs. (Sublette et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Assuming same reproductive mode as in Chasmistes.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Spawns in spring and summer, the date depending on locality. Eggs hatch in 1-2 weeks. Sexually mature in one to several years, at younger age in south than in north (Becker 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ictiobus bubalus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGCA627-10|NC_013071|Ictiobus bubalus| ACGCGCTGATTCTTCTCTACCAACCACAAAGACATTGGCACCCTTTATCTTGTATTTGGTGCCTGAGCCGGAATAGTAGGAACCGCCTTA---AGCCTTCTAATCCGAGCCGAATTAAGTCAACCTGGGTCCCTTCTCGGTGAT---GATCAAATTTATAATGTTATCGTTACCGCCCACGCCTTTGTTATAATCTTCTTTATAGTAATGCCTATCCTAATTGGAGGATTTGGAAACTGACTTGTGCCACTAATG---ATTGGGGCCCCTGACATGGCATTCCCGCGAATAAACAACATAAGCTTCTGACTTCTACCTCCCTCATTCCTTCTACTGCTAGCCTCCTCTGGGGTCGAGGCCGGAGCCGGGACGGGGTGAACAGTATACCCCCCACTTGCGGGTAATCTCGCCCACGCCGGAGCTTCAGTAGACTTG---ACTATTTTCTCACTTCACCTAGCAGGAGTTTCATCAATTCTTGGAGCAATTAATTTTATTACCACAACAATTAACATGAAACCCCCAGCCATCTCTCAATACCAGACACCTCTATTCGTATGAGCCGTACTTGTAACAGCAGTTCTTCTTCTCCTATCTCTGCCTGTCCTGGCTGCC---GGAATTACCATGCTCTTAACAGACCGAAACCTAAATACAACATTCTTTGACCCCGCAGGGGGAGGAGACCCCATCCTCTACCAGCACTTATTTTGATTCTTTGGTCACCCAGAAGTATACATTCTTATTTTACCCGGATTCGGCATTATCTCCCACGTCGTAGCCTACTATGCGGGGAAAAAA---GAGCCTTTTGGCTATATGGGTATAGTCTGGGCTATGATGGCGATCGGCCTTCTAGGCTTTATTGTATGAGCCCATCACATGTTCACTGTCGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ictiobus bubalus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Species: 7
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Ictiobus bubalus

A smallmouth buffalo.
Photo courtesy of Ohio DNR.

The smallmouth buffalo (Ictiobus bubalus) is a fish species found in the major tributaries and surrounding waters of the Mississippi River in the United States as well as some other water systems where it has been introduced.

References


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Hybridization with Ictiobus cyprinellus has been reported (Lee et al. 1980). See Smith (1992) for a study of the phylogeny and biogeography of the Catostomidae.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!