Overview

Comprehensive Description

Biology

Found near the bottom, from close inshore to about 913 m (Ref. 2850). Abundant in cold waters at moderate depths. Feed on mollusks, crustaceans and fishes (Ref. 37955); also echinoderms and worms (Ref. 28499). The spine can be dangerous and cause a painful wound (Ref. 2850). Fishers are reputed to fear the jaws of the ratfish more than they do the dorsal spine. Its flesh is edible but bland and leaves an unpleasant aftertaste (Ref. 28499). The liver was used as a source of machine oil (Ref. 28499).
  • Allen, M.J. and G.B. Smith 1988 Atlas and zoogeography of common fishes in the Bering Sea and northeastern Pacific. NOAA Tech. Rep. NMFS 66, 151 p. (Ref. 6793)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Widespread off the western coast of North America from Southwestern Alaska to Baja and the Gulf of California, being most abundant between British Columbia, Canada and southern California, USA.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: Cape Spencer, Alaska to Bahía Sebastian Vizcaíno, Baja California (Mexico). Isolated population in the northern Gulf of California.
  • Allen, M.J. and G.B. Smith 1988 Atlas and zoogeography of common fishes in the Bering Sea and northeastern Pacific. NOAA Tech. Rep. NMFS 66, 151 p. (Ref. 6793)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: southewastern Alaska to Baja Californa and the northern Gulf of California.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 1; Dorsal soft rays (total): 10
  • Hart, J.L. 1973 Pacific fishes of Canada. Bull. Fish. Res. Board Can. 180:740 p. (Ref. 6885)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

100.0 cm TL (male/unsexed; (Ref. 96339))
  • Love, M.S., C.W. Mecklenburg, T.A. Mecklenburg and L.K. Thorsteinson 2005 Resource Inventory of Marine and Estuarine Fishes of the West Coast and Alaska: A Checklist of North Pacific and Arctic Ocean Species from Baja California to the Alaska-Yukon Border. U.S. Department of the Interior, U.S. Geological Survey, Biological Resounces Division, Seattle, Washington, 98104. (Ref. 96339)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 970 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Prefers muddy, soft bottoms. One of the few chimaeroids that occurs in nearshore waters and has been observed at the surface, but generally occurs at depths of 100 to 913 m. The species also occurs into the intertidal zone in the northern parts of its range. In southern California it has been reported as common on some reef slopes, particularly off Malibu and Redondo Beach below depths of 30 m. In the Gulf of California they are rare in water less than 183 m deep. Prefers water temperatures of 45 to 48°F (Ebert 2003).

Oviparous with peak spawning seasons in the spring and fall. Eggs are laid in pairs every 10 to 14 days over a period of several months. The incubation period within the eggcase is about 12 months, with newborns emerging at about 14 cm TL (Didier and Rosenberger 2002). The spine is known to be venomous in this species (Halstead and Bunker 1952). Johnson and Horton (1972) reported that attempts at age determination based on length-frequency distributions were inconclusive and that the use of hard body parts for ageing was unsuccessful. Diet consists of a wide range of bottom dwelling invertebrates and fishes. They are known to be cannibalistic, feeding on both free-swimming individuals and on their own eggcases (Johnson and Horton 1972).

Life history parameters
Age at maturity (years): Unknown.
Size at maturity (body length): Female: 24 to 25 cm BDL; Male: 18.5-20.0 cm BDL.
Longevity (years): Unknown.
Maximum size (total/body length): 60 cm TL; 36 cm BDL.
Size at birth: 14 cm TL.
Average reproductive age (years): Unknown.
Gestation time (months): Unknown.
Reproductive periodicity: Unknown.
Average annual fecundity or litter size: Unknown.
Annual rate of population increase: Unknown.
Natural mortality: Unknown.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 0 - 913 m (Ref. 6793), usually 50 - 400 m (Ref. 43939)
  • Mecklenburg, C.W., T.A. Mecklenburg and L.K. Thorsteinson 2002 Fishes of Alaska. American Fisheries Society, Bethesda, Maryland. xxxvii +1037 p. (Ref. 43939)
  • Allen, M.J. and G.B. Smith 1988 Atlas and zoogeography of common fishes in the Bering Sea and northeastern Pacific. NOAA Tech. Rep. NMFS 66, 151 p. (Ref. 6793)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4063 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2062 samples.

Environmental ranges
  Depth range (m): 3 - 437
  Temperature range (°C): 5.424 - 17.687
  Nitrate (umol/L): 0.334 - 37.822
  Salinity (PPS): 32.340 - 34.190
  Oxygen (ml/l): 1.139 - 5.506
  Phosphate (umol/l): 0.426 - 2.880
  Silicate (umol/l): 3.551 - 70.929

Graphical representation

Depth range (m): 3 - 437

Temperature range (°C): 5.424 - 17.687

Nitrate (umol/L): 0.334 - 37.822

Salinity (PPS): 32.340 - 34.190

Oxygen (ml/l): 1.139 - 5.506

Phosphate (umol/l): 0.426 - 2.880

Silicate (umol/l): 3.551 - 70.929
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 913m.
Recorded at 913 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeds on fish and benthic invertebrates (Ref. 2850). Inhabits rocky regions between Alaska and California (Ref. 9137). A carnivore (Ref. 9137).
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct pairing during copulation (Ref. 205). The female extrudes two eggs at a time (each contained in a capsule) and may take up to 30 hours to extrude all her egg cases, which then hang from her body on a long filament for another 4 to 6 days. The egg cases end up planted vertically in the mud or just lying with filaments entangled on the bottom. Females extruding egss can be found year-round (Ref. 28499).
  • Armstrong, R.H. 1996 Alaska's fish. A guide to selected species. Alaska Northwest Books. 94 p. (Ref. 28499)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hydrolagus colliei

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTGGCACCCTTTACCTCCTTTTTGGTGCTTGAGCAGGTATAGTAGGAACTGCCCTAAGCCTATTAATTCGCGCTGAATTAAATCAACCCGGAGCTCTAATAGGGGATGATCAAATTTATAATGTTATCGTTACTGCCCATGCTTTTGTTATAATCTTCTTCATAGTTATACCCATTATGATCGGAGGTTTTGGTAACTGACTTGTACCTTTAATAATTGGAGCGCCAGATATAGCATTTCCCCGAATAAATAATATAAGTTTTTGACTCCTCCCTCCCTCTTTCTTACTTCTTTTAGCCTCTGCAGGAGTAGAGGCAGGAGCTGGAACTGGATGAACTGTCTACCCCCCTTTAGCAGGCAACCTAGCACATGCAGGAGCATCTGTAGACCTGACTATCTTCTCTCTCCACCTAGCTGGTATCTCTTCAATTCTAGCCTCCATTAACTTTATTACTACAATTATTAATATAAAACCTCCCTCTATTACCCAATATCAAACCCCTTTATTTGTATGATCTATTTTAATTACTACAATCCTTCTATTATTATCTTTACCAGTTTTAGCAGCCGGTATTACAATATTACTTACAGACCGAAACCTAAATACAACATTCTTTGACCCAGCAGGAGGAGGAGACCCTATTTTATATCAACACTTGTTCTGATTCTTCGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hydrolagus colliei

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2006

Assessor/s
Dagit, D.D.

Reviewer/s
Ebert, D.A., Kyne, P.M., Fowler, S.L. & Compagno, L.J.V. (Shark Red List Authority)

Contributor/s

Justification
A common species found in nearshore waters to depths of 913 m along the west coast of North America from Southwestern Alaska to Baja California, Mexico (including the Gulf of California). This species appears to be abundant throughout most of its range, although not common in Alaskan waters. One of the best studied of all chimaeroid fishes, life history studies indicate segregation of populations by size and sex and seasonal abundance in parts of its range. Limited information on reproduction indicates that eggs are laid in pairs every 10 to 14 days over a period of several months with development taking up to 12 months. Available fisheries data from the Northeast Pacific indicates this species comprises a large proportion of the vertebrate biomass in Puget Sound (Quinnell and Schmitt 1991), although reported catches from California, Oregon and Washington are very small. This ratfish is not a targeted species and appears to be collected and utilized only locally in the Northeast Pacific and is taken as a bycatch in commercial trawl fisheries. This species is rarely landed from the Gulf of California where it appears to inhabit waters at depths greater than 180 m. Evidence does not suggest that the small local fishery and/or bycatch are impacting the population in the Gulf of California. Given its wide distribution, depth range, abundance in some areas and evidence to suggest that the impact of fisheries is minimal, the species is assessed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Very little is known about their movement patterns other than they seem to be seasonally abundant in some areas. Populations appear to segregate by sex and size with larger fish moving into shallower waters while juveniles aggregate in deeper waters (Mathews 1975, Quinn et al. 1980).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Potentially threatened by inshore commercial trawling activities. A fishery for this species has been suggested, but has never proven commercially viable; however, there is the potential this "trash" species may become targeted as other more valuable species are depleted.

Available fishery data from the Northeast Pacific indicates this species comprises a large proportion of the vertebrate biomass in Puget Sound (Quinnell and Schmitt 1991), although reported catches from California, Oregon and Washington are very small. For example, State of Washington Department of Fisheries reported only 8 round pounds for 1992-1993 (Keith Wolf, pers. comm.) and Oregon landings in 1992 and 1993 were 250 pounds and 98 pounds, respectively (John Griffith, pers. comm.). This species is not a targeted species and appears to be collected and utilized only locally in the Northeast Pacific and is taken as a bycatch in commercial trawl fisheries. This species is rarely landed from the Gulf of California and appears to inhabit waters at depths greater than 180 m. Evidence does not suggest that the small local fishery and/or bycatch are impacting the population in the Gulf of California.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No management or conservation measures are currently known to be in place, except in Oregon where trawlers utilize gear to avoid ratfish and other unwanted bycatch. This species is generally avoided as much as possible as the spiny frontal tenaculum and dorsal spine tangles in nets.

The development and implementation of management plans (national and/or regional e.g., under the FAO International Plan of Action for the Conservation and Management of Sharks: IPOA-Sharks) are required to facilitate the conservation and management of all chondrichthyan species in the region.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: public aquariums
  • Newman, L. 1995 Census of fish at the Vancouver aquarium, 1994. Unpublished manuscript. (Ref. 9183)
  • Krupp, F. and W.A. Bussing 1995 Quimeras. p. 793-798. In W. Fischer, F. Krupp, W. Schneider, C. Sommer, K.E. Carpenter and V. Niem (eds.) Guia FAO para Identification de Especies para lo Fines de la Pesca. Pacifico Centro-Oriental. 3 Vols. FAO, Rome. (Ref. 9266)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Spotted ratfish

The spotted ratfish, Hydrolagus colliei, is a chimaera found in the north-eastern Pacific Ocean. Often seen by divers at night in the Pacific Northwest, this harmless shark relative gets its characteristic name from a pointed rat-like tail. The ratfish lays leathery egg cases on the bottom of muddy or sandy areas which are often mistaken by divers as something inanimate. While mainly a deep-water species, it occurs at shallower depths in the northern part of its range. The generic name, Hydrolagus, comes from the Greek words ὕδωρ, meaning water,[1] and λαγώς/λαγῶς, meaning hare,[1] and the specific name honors Alexander Collie, who was a ship surgeon and early naturalist. The ratfish is not typically eaten by humans and is not commercially caught.

Physical description[edit]

Hydrolagus colliei 03.jpg

The spotted ratfish has a very distinct appearance compared to unrelated fish species. The female is up to 38 inches (97 cm) long, much bigger than the male. These fish have a smooth and scaless skin that is a silvery-bronze color, often with sparkling shades of gold, blue, and green. The speckled white spots along their back contribute to their name. Dark edges outline both the caudal and dorsal fins, whereas, the pectoral fins have a transparent outline. The ratfish’s pectoral fins are large and triangular, and extend straight out from the sides of their bodies like airplane wings. They have a venomous spine located at the leading edge of their dorsal fin. The tail of the ratfish constitutes almost half of their overall length and closely resembles a pointed rat-like tail. The body of this fish is supported by cartilage rather than bone. It has a duckbill shaped snout and a rabbit-like face. The mouth is small and contains forward directed, incisor-shaped teeth, that act as plate-like grinding teeth. One of their most mesmerizing features is their large emerald green eyes which are able to reflect light, similar to eyes of a cat.

Habitat[edit]

Hydrolagus colliei1.jpg

The spotted ratfish can be found in the north-eastern Pacific Ocean. They can most commonly be found between the Pacific Northwest. The range of depths in which this fish is found extends from 0 to 3,000 feet (0 to 914 m) below sea level. Further north the spotted ratfish lives close to the shore. On the southern end of their range, they live in deeper waters. Ratfish tend to move closer to shallow water during the spring and autumn, then to deeper water in summer and winter. Spotted ratfish can most commonly be found living near the bottom of sand, mud or rocky reefs of the ocean floor. Unlike most of its relatives which are entirely restricted to deep waters, the spotted ratfish has been held in public aquaria.[2]

Diet[edit]

The spotted ratfish swims slowly above the seafloor in search of food. Location of food is done by smell. Their usual hunting period is at nighttime, when they move to shallow water to feed. Spotted ratfish are particularly drawn to crunchy foods like crabs and clams. Besides crabs and clams, the spotted ratfish also feeds on shrimp, worms, small fish, small crustaceans, and sea stars. Species known to predate on the spotted ratfish include soupfin sharks, dogfish sharks, Pacific halibut, and Pigeon guillemots.

Reproduction[edit]

Like some sharks, spotted ratfish are oviparous. Their spawning season peaks during the spring to autumn months. During this time, the female releases up to two fertilized eggs into sand or mud areas of the seabed every 10 to 14 days. The extrusion process can last anywhere from 18 to 30 hours and the actual laying can last another four to six days. The egg sack is leather-like, five inches long, and has a filament connected to it which is used to attach it to the ocean floor when it is let go by the mother. It is not unheard of to see a female ratfish swimming around her newly laid eggs, in hopes of preventing predators from finding them. Development of the egg can take up to a year, which can be dangerous because the eggs are sometimes mistaken for inanimate objects by divers. When the young finally hatch, they are about 5.5 inches (14 cm) in length and grow, reaching 11.8 inches (30 cm) in length their first year.

Behaviour[edit]

The ratfish prefers to maintain a safe distance from divers, and are usually not aggressive. However, if they feel their territory has been invaded, the ratfish is able to inflict a mildly toxic wound. As they swim, the ratfish perform barrel rolls and corkscrew turns, as if they are flying.

Albino Puget Sound ratfish[edit]

A rare albino Puget Sound ratfish was discovered near Whidbey Island, Washington. It is the only pure albino among the 7.2 million specimens in the University of Washington's fish collection.[3]

References[edit]

  1. ^ a b Liddell, H.G. & Scott, R. (1940). A Greek-English Lexicon. revised and augmented throughout by Sir Henry Stuart Jones. with the assistance of. Roderick McKenzie. Oxford: Clarendon Press.
  2. ^ Tozer, H., & D. D. Dagit (2004). Husbandry of Spotted Ratfish, Hydrolagus colliei.
  3. ^ Scientists discover rare albino ratfish
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!