Overview

Brief Summary

Biology

These large fish can take up to 18 years to reach sexual maturity and even then will only spawn once in every 2 to 4 years (2). Adults migrate upstream in the spring or autumn to spawn in shallow pools; a single female can produce between 300,000 and 7.5 million eggs, which are attached to stones on the pool floor (2). Once they have emerged, juveniles migrate downstream to the sea (2).  The fleshy barbels in front of the mouth are used to search for prey on the seafloor and riverbed (5); juveniles feed mainly on small invertebrates whereas adults tend to consume fish such as anchovy, gobies and herring (2). Belugas spend the majority of their time in the lower reaches of the water column, near to the substrate (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The beluga is the largest sturgeon in the world and the largest European freshwater fish; it can reach up to 5 metres in length (2). This ancient fish has an elongated body shape and a flattened, slightly upturned snout (3), with the mouth located underneath (4). There are five rows of bony plates (or 'scutes') that run the length of the body, one along the back, one on each flank and two on the undersurface (3). The short, fleshy barbels in front of the mouth are feathered at the ends (2). The body is predominantly dark grey or greenish whilst the belly tends to be white (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Pelagic at the sea, following its prey. Undertakes upriver migration to spawn. Juveniles occur in shallow riverine habitats during their first summer. Spawns in the main course of large and deep rivers with strong current and on stone or gravel bottom (Ref. 59043). Feeds mostly on sea fishes (Black Sea whiting, anchovies, flatfishes, gobies, fry of bottom-living fishes), also crustaceans, mollusks, mysids and amphipods. Fisheries are based almost entirely on the value of the caviar, but meat also is sold fresh, smoked and frozen; eaten broiled, boiled, fried and baked (Ref. 9988). Bester, a hybrid of female Huso huso and male sterlet Acipenser ruthenus, has been successfully cultivated for its high quality eggs (Ref. 9988). The largest sturgeon and largest European freshwater fish. In Guinness Book of Records as the most expensive fish (Ref. 6472). Threatened due to overfishing for meat at the sea and for caviar in estuaries. These threats will soon cause global extinction of the natural populations. Survival can only depend on stocking (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Eurasia: Caspian, Black, Azov and Adriatic Sea basins. Considered critically endangered (Ref. 59043). Appendix III of the Bern Convention (protected fauna). International trade restricted (CITES II, since 1.4.98; CMS Appendix II).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species has been recorded in the basins of the Caspian, Black, Azov, and Adriatic Seas, however its current native wild distribution is restricted to the Black Sea (in the Danube only) and the Caspian Sea (in the Ural only). It is one of the largest anadromous fish in the Caspian Sea, where at least three Beluga populations have been identified by microsatellite technique (Pourkazemi 2008). It does occur in the Azov Sea, and Volga River but these are stocked fish.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

In the Caspian Sea and the tributaries that flow into it.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The beluga sturgeon, Huso huso, is endemic to the Ponto-Caspian Sea region that includes the Caspian Sea (the largest inland body of water in the world) as well as the Sea of Azov and the Black Sea (Bemis & Kynard 1997, Berg 1948).

Acipenseriformes, including fossil species, are restricted to the Northern Hemisphere; closely tied to former Laurasian landmasses (Eurasia, North America) (Bemis et al. 1997). The lone congener of the beluga sturgeon, the kaluga (Huso dauricus) is endemic to the Amur River, which runs along part of the Chinese/Russian border (Krykhtin & Svirskii 1997). Although these two species are the only members in the genus Huso, there are some doubts whether they are sister species (Doukakis 2000).

Biogeographic Regions: palearctic (Native )

  • Bemis, W., B. Kynard. 1997. Sturgeon rivers: an introduction to acipenseriform biogeography and life history. Environmental Biology of Fishes, 48: 167-183.
  • Bemis, W., E. Findeis, L. Grande. 1997. An overview of Acipenseriformes. Environmental Biology of Fishes, 48: 25-71.
  • Berg, L. 1948. Freshwater Fishes of the U.S.S.R. and adjacent countries Part I. Israel Program for Scientific Translations; [available from the Office of Technical Services, U.S. Dept. of Commerce, Washington] 1962.
  • Doukakis, P. 2000. Systematics and conservation genetics of sturgeons (Order Acipenseriformes). Yale University: Unpublished Dissertation.
  • Krykhtin, M., V. Svirskii. 1997. Sturgeon catch and current status of sturgeon stocks in the Amur River. Pp. 29-34 in V Birstein, A Bauer, A Kaiser-Pohlmann, eds. Sturgeon Stocks and Caviar Trade WorkshopProceedings of a Workshop Held 9-10 October in Bonn, Germany. Bonn, Germany: IUCN Occasional Paper No 17.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Baltic sea, Black Sea, European waters (ERMS scope), Greek Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Black Sea, Caspian sea, Adriatic Sea and Sea of Azov.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Atlantic, Mediterranean Sea, Eastern Europe: Aegean, Black, Azov and Caspian seas and Sea of Marmara and adjacent watersheds.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found in Europe, principally in the Caspian Sea with spawning occurring mainly in the Volga River (9). Beluga are also found in and around the Black, Caspian and Azov Seas as well as the Adriatic (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 62 - 73; Analspines: 0; Analsoft rays: 28 - 41
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Acipenseriformes are primitive actinopterygians that have a fossil record dating back to the Lower Jurassic (200 mya), with an origin perhaps even earlier in the Mesozoic (Bemis et al. 1997). Acipenseriformes possess a unique blend of teleost-like character (high fecundity small egg size) and elasmobranch-like characters (cartilaginous endoskeleton, hyostylic jaw suspension). They also possess a heterocercal caudal fin and remnants of ganoid scales; both are uncommon among extant actinopterygians. Sturgeon species are noted by a spindle-shaped body with five rows of bony scutes and a long snout with sensory barbels.

The genus Huso can be distinguished from other sturgeon by possession of branchiostegal membranes that are joined and form a flap (Berg 1948). The two species in the genus also possess a relatively large crescent shaped mouth (Berg 1948). Berg (1948) gives the following key for distinguishing between Huso congeners:

  1. H. dauricus First dorsal scute the largest. Barbels without foliate appendages. Fewer than 60 rays in dorsal fin. Found in the Amur Basin.
  2. H. huso First dorsal scute the smallest. Barbels with foliate appendages. Usually not less than 60 rays in dorsal fin. Found in the basins of the Caspian, Black, and Adriatic Seas.

Among freshwater fish species, H. huso may have be the largest that has ever lived (Freedman 1999). Based on Debus's (1997) reports on bones excavated from the 14th century, one fifth of all H. huso catches of that time were between 4-6 meters in length. Beluga this size today are extremely rare. Bemis et al. (1997a) report that this species may have reached nearly ten meters in length. The largest beluga ever recorded measured six meters in length and weighed 3,200 kg (Berg 1948, Birstein 1993, Freedman 1999). The decreased size of individuals today may reflect the shift to catching younger individuals because of overfishing of older and larger fish, polluted living conditions for beluga in the Caspian and other parts of its range, and the possible loss of large individuals from the gene pool. Large beluga sturgeon have been targeted by fisherman for centuries.

Sexual dimorphism is weakly expressed, and may only be notable in overall size and weight. This dimorphism is particularly notable in gravid females that bear the weight of heavy egg masses (Berg 1948, Raspopov 1993).

Range length: 6 (high) m.

Other Physical Features: bilateral symmetry

Average mass: 1.1396e+06 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 5000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

800 cm TL (male/unsexed; (Ref. 59043)); max. published weight: 3,200.0 kg (Ref. 59043); max. reported age: 118 years (Ref. 47437)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Snout moderate and pointed, turning slightly upward. Lower lip not continuous, interrupted at center. Barbels oval or flat, leaf-like posteriorly, reaching almost to mouth. Five rows of scutes, dorsal 11-14 (first one smallest), lateral 41-52 on each side, ventral 9-11 on each side. Back ash-grey or greenish, flanks lighter, belly white.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; anadromous (Ref. 51243); freshwater; brackish; marine; depth range 70 - 180 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
At sea, this species is found in the pelagic zone, following food organisms. It migrates further upriver to spawn than any other sturgeon; however this migration has now been disrupted due to river regulation (in the Danube drainage up to Morava River). It spawns in strong-current habitats in the main course of large and deep rivers on stone or gravel bottom.

This species is anadromous (spending at least part of its life in salt water and returning to rivers to breed). Males reproduce for the first time at 10-15 years, females at 15-18 years, with an estimated generation length of 20-25 years. This species spawns every 3-4 years in April-June. A complicated pattern of spawning migrations includes one peak in late winter and spring and one in late summer and autumn. In spring, it migrates from the sea before spawning. Individuals migrating in autumn remain in the rivers until the following spring. Spawning occurs at temperature from 6 to 14 °C in the channel and spring flooded spawning grounds at a current speed of 0.8-1.2 m / sec. Spawners the late winter/spring run dominate the spawners in the Volga River (80%), whereas the late summer/autumn run dominates in the Ural River. Yolk-sac larvae are pelagic for 7-8 days and drift with current. Juveniles migrate to sea during their first summer and remain there until maturity.

In the past this species was the largest fish of the Caspian Sea, reaching lengths of more than 5 m and a weight of 1,000 kg. The lifetime of such large specimens, apparently, exceeded 100 years. Currently there are individuals up to 280 cm, weighing up to 650 kg. Average length of females is 240, males is 220 cm, weight respectively is 130 and 65 kg. The maximum age of 53 years was observed in 2003.

Various environmental factors influence the distribution of the species in the Caspian Sea. One factor is water temperature, as mature Beluga prefer water temperatures not exceeding 30°C. They spend the spring and summer mostly in the northern and middle parts of the Caspian Sea and then move southwards to spend the winter in the southern areas, which coincides with highest densities of food organisms. The diet includes roach Rutilus rutilus (L.), common carp (Cyprinus carpio L.), herrings (Clupeidae), kilka (Clupeonella), crayfish (Astacus), gobies (Gobiidae), pike-perch (Sander lucioperca (L.)), birds, sturgeons (Acipenseridae), and even seal (Khodorevskaya et al., 1995). Mature individuals of Beluga are less sensitive to low temperature than the immature, as they feed in the northern part of the Caspian Sea under the ice. With water temperatures decreasing, Belugas reduce the range of depths at which they feed. Immature individuals in spring and autumn prefer the more desalinated sea areas. In summer the highest concentrations occur at the salinity of 3 to 7%. The largest concentrations of Beluga in the northern Caspian occur during the migration of its main prey organisms (herrings, kilka, gobies, roach, etc.).

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Beluga sturgeon are considered euryhaline, capable of moving freely between freshwater and estuaries. Species of the order Acipenseriform often enter rivers for migration to other areas or for spawning.

Beluga sturgeon spawn at a water temperature of 9-11 degrees C and they are sensitive to these water conditions during periods of spawning (Levin 1997). However, other than spawning times, adults are fairly resilient to many environmental factors, particularly considering that they live in some of the most polluted and altered waterways in the world.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: pelagic ; lakes and ponds; rivers and streams

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 70 - 180m.
From 70 to 180 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Belugas are anadromous fish, spending most of their life at sea but migrating to fresh water in order to spawn (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeds on fish and benthic invertebrates (Ref. 231).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Adult beluga sturgeon are mainly piscivores, swimming at middle depths and preying mostly on pelagic fish species. This is unlike most other sturgeon species, which normally feed on bethic invertebrates while swimming along the bottom. In the Black Sea they feed on species such as flounder (Platichthys flesus) and other flatfish, gobies (Gobiidae), and Black Sea anchovy (Engraulis encrasicolus) (Berg 1948). In the Caspian they are reported to feed mainly on the Caspian roach (Rutilus rutilus), but also on herring and native gobies. Little is known about the diet of larval and juvenile H. huso.

Unlike other Ponto-Caspian sturgeon species beluga do not congregate, but remain dispersed when not migrating (Levin 1997). Sturgeon species can endure long periods of starvation and often do not eat for long periods during spawning migrations (Beamesderfer & Farr 1997)

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Beluga are the largest piscivores in the Pronto-Caspian region. It difficult to determine their role in the past given their endangered status, but in periods where they were quite abundant (before 1950) they would have been among the top predators in the Ponto-Caspian, playing a similar role as the fish eating seals of the region.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The large size of adults makes predation on them difficult, and a natural predator besides humans is unknown. Many juveniles fall prey to pollution and hydroelectric dams (Altuf'ev 1997). Most populations are supported solely by hatchery released individuals. In the 1980's the number of young beluga's released from the Volga river per year was 19.4 million. The survival rate of these individuals was estimated to be 0.1% (Khoderevskya 1997). The number killed by natural causes or causes other than fishing pressures has not been documented.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Huso huso preys on:
Actinopterygii
Mollusca
Crustacea

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Enters rivers from March, usually April and May (also in autumn). Survives largely by artificial propagation. About 360,000-7,700,000 eggs per female. Females carry eggs only once every five to seven years (Ref. 9988).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

Since fisherman or poachers capture nearly all beluga sturgeon before they can die of natural causes, the development of this species is little known. Length and weight increases much more rapidly earlier in the life history of these fish than during later in ontogeny (Raspopov 1993). Length and weight can range greatly in a given age class depending on environmental conditions of the sturgeon habitat (Raspopov 1993).

After hatching, downstream migrations of beluga larvae occur between May and June (Levin 1997). From hatcheries data, it is observed that the weight of beluga after 28-45 days averages around 2.5-3 g (Levin 1997). By the time they enter the sea they are 6-11 cm in length. Recently hatched larvae are also purported to move at about 24 km per day during their migration to the sea. By the forth year, beluga may reach a meter in length. In the spring, mature fish enter the rivers to breed, while younger individuals (less than 10 years) disperse near the Northern Caspian, their distribution based mainly on ecological factors like water temperature and benthic silt (Levin 1997).

Beluga sturgeon mature later than most other acipenseriforms, usually after their 12th year (Lelek 1987). Raspopov (1993) estimated that beluga sturgeon in the Caspian become sexually active every 4-8 years for females, and every 4-7 years for males. Under favorable conditions, a beluga may spawn up to nine times in its lifetime.

From 1987-1997 in the Volga River (which was once the most important spawning habitat of beluga), female spawners have ranged from 199 to 236 cm, and weighed between 48 to 160 kg (Levin 1997). These are much smaller than recorded sizes for previous years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The beluga sturgeon is one of the most long-lived of all vertebrate species. Reportedly it may have reached ages over 100 years (Ono et al. 1983, Birstein 1993, Khodorevskya 2000). Most acipenseriform species mature at a late age (normally greater than 10 years). Females mature later than males, normally after 15 years for females and 10 for males (Berg 1948). Individuals no longer die of natural-age related causes, with most being fished soon after reaching reproductive maturity. The world demand for caviar (sturgeon and paddlefish roe) is to blame for the shortened lifespan of these fish. The demand far exceeds the available supply, forcing legal fishers to catch increasingly younger and smaller fish, and providing fuel for a growing black market. Individuals today are not found beyond their 56th year (Raspopov & Novikova 1997).

Typical lifespan

Status: wild:
56 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 118 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Beluga do not spawn every year and females will resorb eggs unless conditions are suitable (Artyukhin et al. 1979). Sturgeon can take between 6 and 25 years to reach sexual maturity, and females of this species may reproduce only every four to eight years (Raspopov 1993).

Mating System: polygynandrous (promiscuous)

Beluga sturgeon are anadromous, migrating to freshwater spawning grounds in rivers from larger seas (either the Caspian, Azov or Black). Migrations occur in these populations twice a year in spring and autumn (Berg 1948, Hensel & Holcik 1997). Some authors have divided beluga populations into Winter or Spring races by the period they choose to spawn (Berg 1948). Distances for spawning migrations for this species are legendary, exceeding 2500 km in the Danube and Volga basin (Hensel & Holcik 1997, Khoderevskaya et al. 1997).

Breeding season: winter and autumn race (varying depending on Caspian, Asov or Black sea population)

Range age at sexual or reproductive maturity (female): 17-29 (high) years.

Average age at sexual or reproductive maturity (female): 6-30 years.

Range age at sexual or reproductive maturity (male): 11-23 (high) years.

Average age at sexual or reproductive maturity (male): 6-30 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; sexual ; fertilization (External ); oviparous

These sturgeon typically spawn large numbers of eggs in shallow, gravely sites, and do not provide parental care (Bemis et al. 1997, Lelek 1987).

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Huso huso

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACCCGTTGATTCTTTTCTACTAACCACAAAGATATTGGCACCCTGTATTTAGTATTTGGTGCCTGAGCAGGCATAGTCGGCACAGCCCTCAGCCTTCTGATCCGTGCCGAACTGAGCCAACCCGGTGCCTTGCTTGGCGATGACCAGATCTACAATGTTATCGTCACAGCCCACGCCTTTGTCATGATTTTCTTTATAGTAATACCCATCATAATTGGCGGATTCGGAAACTGATTGGTCCCCCTAATAATTGGAGCCCCAGACATGGCATTTCCTCGCATGAACAACATGAGCTTCTGACTTCTACCCCCATCCTTCCTACTCCTTTTGGCCTCCTCTGGGGTAGAGGCCGGAGCCGGTACAGGATGAACTGTTTACCCCCCACTGGCGGGAAACCTGGCCCATGCAGGAGCCTCTGTAGACCTAACCATTTTCTCCCTCCATCTGGCCGGGGTTTCGTCCATTCTGGGGGCTATTAATTTTATTACCACAATCATTAACATGAAACCCCCCGCAGTATCCCAATATCAGACACCTCTATTTGTGTGATCTGTGTTAATCACGGCCGTACTTCTCCTACTATCACTGCCAGTGCTAGCTGCAGGGATCACAATACTCCTAACAGACCGAAATTTAAACACCACCTTCTTTGACCCAGCCGGAGGAGGAGACCCCATCCTCTACCAACACCTATTTTGATTCTTTGGCCACCCAGAGGTGTACATTCTAATTCTACCAGGATTCGGCATGATCTCCCATATTGTAGCATACTATGCCGGCAAAAAAGAACCTTTTGGCTACATAGGAATAGTATGGGCTATGATGGCCATTGGACTATTAGGCTTTATCGTATGAGCTCATCACATATTTACAGTTGGAATGGACGTAGACACACGGGCCTACTTTACCTCCGCCACAATAATTATTGCCATCCCCACAGGTGTCAAAGTCTTTAGCTGATTAGCCACCCTTCACGGCGGCTCAATTAAATGAGATACCCCCCTACTTTGAGCCTTAGGCTTTATTTTCCTATTCACAGTGGGAGGCTTAACGGGAATTGTCCTGGCCAACTCGTCTCTAGATATTGTACTTCACGACACCTACTACGTTGTAGCACATTTTCACTATGTATTATCAATGGGGGCTGTGTTCGCCATTATAGGGGCCTTCGTACACTGATTCCCACTTTTCACAGGTTATACACTACACGGCACCTGATCCAAAATCCACTTTGCTGTAATATTTGTAGGTGTCAATTTAACATTCTTCCCCCAACACTTCCTAGGCCTCGCAGGAATGCCCCGCCGATACTCAGACTATCCGGACGCATACGCCCTGTGAAATACCGTCTCCTCAATCGGCTCACTAATCTCATTGGTTGCCGTGATTATATTCCTATTCATCCTATGAGAAGCATTCGCGGCCAAACGAGAAGTTATGTCAGTCGAACTAACAACCACAAATGTAGAGTGACTTCACGGCTGCCCACCCCCATATCACACCTATGAAGAGCCTGCCTTTGTGCAAGTGCAACCAACCAACTAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Huso huso

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 49
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EX
Extinct

Red List Criteria

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Sturgeon Specialist Group

Reviewer/s
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A1acde+2d

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Sturgeon Specialist Group

Reviewer/s
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A1acde+2d

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Sturgeon Specialist Group

Reviewer/s
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2bcd

Version
3.1

Year Assessed
2010

Assessor/s
Gesner, J., Chebanov, M. & Freyhof, J.

Reviewer/s
Pourkazemi, M. & Smith, K.

Contributor/s

Justification
The species was historically known from the Caspian, Black, Azov and Adriatic Sea basins. It has been extirpated from the Adriatic (in the early 1970s, Gessner pers. comm.) and Azov Seas due to overfishing and loss of spawning sites due to dams. As the species is very long lived, individuals can still be caught in areas where their spawning sites have been cut off. The last wild population in the Black Sea basin migrates up the Danube river. All other Black Sea stocks are almost extirpated due to overfishing and impoundment of spawning rivers. In the Caspian basin, the last wild population migrates up the River Ural. The Volga population depends on stocking as the construction of Volgograd dam led to the loss of almost all of the species spawning sites in the river. Most of the few recorded females are in their first year of maturation. Based on catch data, and number of recorded spawning individuals it is estimated that the species has seen a wild native population decline of over 90% in the past three generations (a minimum of 60 years) and overfishing for meat and caviar will soon cause global extinction of the remaining natural wild populations. In the immediate future, survival can only depend on stocking and effective fisheries management and combating illegal fishing. Range states are also encouraged to provide protection to the species spawning and feeding grounds.

History
  • 1996
    Endangered
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A1acde+2d

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Sturgeon Specialist Group

Reviewer/s
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Since it is difficult to distinguish between a male and a female without dissection, males are as susceptible to fishing pressure as females full of roe. To keep up with fishing pressure, Khoderevskya (1999) reports that between 15-20 million fingerlings need to be released annually from hatcheries in order to maintain a beluga population in the Caspian Sea. This figure is not currently being met. Birstein and colleagues (1997) report that in 1995 due to the lack of broodstock, there was no artificial breeding or natural reproduction in the Volga River that year. This river historically held most of the world's beluga spawners and releases (Artyukhin 1997). International trade in beluga caviar should be halted in order to relieve the pressure on this species. Although currently placed under CITES Appendix II, an uplisting to Appendix I would provide a working ban on international trade. The IUCN has also listed this species as critically endangered. As the U.S. is the second largest importer of beluga caviar in the world, placement of this species under the U.S. Endangered Species Act would provide immediate relief from much of the pressure to fish this species. Declaration of any ban must also be enforced, as a well-established black market has been successfully operating since the fall of the Soviet Union (DeMeulanaer & Raymakers 1996, Khordorevskaya et al. 1997).

Habitat destruction also threatens this species. Dams block migratory routes. In its major spawning river the Volga, only a small percentage (less than 20%) of beluga are able to migrate upstream past the major dam on that river the Volgograd Dam (Rochard et al. 1990, Gertsev 1999). Fish lifts and elevators must transport these individuals across the dam. Often they find water conditions on the other side of the dam unsuitable for reproduction because of water temperature and flow rates. Problems of migrating larvae moving toward adult grounds upstream from the dam are little studied. Debus (1997) considers that the passage of juveniles downstream the Volga River as normally lethal, because juveniles do not survive passage through the hydroelectric power turbines of the dams.

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Threatened
Date Listed: 04/21/2004
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: T

For most current information and documents related to the conservation status and management of Huso huso , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN - A2d) on the IUCN Red List 2002. Listed on Appendix II of CITES and Appendix II of the Convention on Migratory Species (CMS or Bonn Convention) (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Global fisheries statistics show that there has been a 93% decline in catch from 1992 (520 tonnes) to 2007 (33 tonnes) (FAO 2009).

The number of Beluga annually entering the Volga dropped from 26,000 (1961-65) to 2,800 (1998-2002), a decline of 89% in 33 years (Khodorevskaya et al. 2009). Only 2,500 migrated up Ural in 2002 (Pikitch et al. 2005).

Currently it is thought that nearly 100% of Beluga in the Volga are hatchery reared, but there is evidence of spawning elsewhere in its distribution (Khodorevskaya et al. 2009). Despite intensive restocking in the Caspian Sea (91% of each generation is estimated to come from hatchery stock), the annual catch in the northern Caspian Sea has drastically fallen. Catches in the Caspian were: 1945-55 average of 1,380 tonnes; 1956-65 average of 1,283 tonnes; 1966-75 average of 1,623 tonnes; 1976-85 average of 849 tonnes; 1986-95 average of 506 tonnes; 1996-2003 (latest data) average of 60.8 tonnes (in Doukakis et al. accepted). This shows a decline of 95%. The official catch statistics support this trend, as they show that the species was abundant in 1938 and then stable to the late 1980s, with the major decline starting from 1990 to the present showing over a 90% decline in the past 60 years (see Khodorevskaya et al. 2009). The agreed Beluga catch quota for all of the Caspian Sea (2007/8 - 28th session of the Commission) was 99.8 tonnes; this quota was not achieved. The proportion of Beluga (to other sturgeon species) in trawl catches of the northern Caspian Sea in all seasons of observations was at an average of 11%. Over the recent years, this percentage has decreased to 8.3%, and the catch of beluga during trawl surveys did not exceed 31 specimens per year (Khodorevskaya et al. 2009).

Spawning numbers for the Volga from 1961-65 was 26,000, whilst in 1996/1997 it was 1,800 (Khodorevskaya et al. 2000), with 2,800 in 1998-2002 (Khodorevskaya et al. 2009).

In the Sea of Azov, between 1979-1981 it is estimated that 551,000 individuals existed (from stocked, and dominated by sub-adult and juveniles); in 1988-1993 there were 25,000 and after 1994 they were only caught sporadically, despite banning of commercial fishing of Beluga in 1986. After 1986 the major threat was from bycatch. Since 1994, 98% of individuals recorded in the Azov Sea have been juvenile. In 2001 the first individuals were produced from captive bred individuals and released (Chebanov and Koziritskaya 2007).

Catches in the Danube have also declined. In the mid-Danube the annual catch was 23 tonnes (average between 1972-76) which dropped to 7.5 tonnes (average between 1985-89), a decline of 67% in around 12 years (CITES 2000). In 2002, 21.3 tonnes were caught in Romania, whilst only 8.4 tonnes were caught in 2005, showing a 60% decline in three years. The percentage of catch quota achieved in Romania was 85% in 2002, 84% in 2003, 46% in 2004, and 34% in 2005. In 2006 the catching of Beluga was banned in the Danube (Paraschiv et al. 2006).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Critically Endangered (CR) (A2bcd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Overfishing at sea and poaching in estuaries and rivers for meat and caviar is a major threat to the species. Overharvesting and a sharp increase in poaching has led to the largest and most mature specimens being removed from the population and reducing natural reproduction to almost zero (Krassikov and Fedin 1996). In the Ural river current fishing rates are 4 to 5 times sustainable levels (F Max) (Doukakis et al. accepted).

Bycatch is also a threat to the species. The species caviar is very high value (8,000 USD per kilo in 2009).

Impoundment of rivers has destroyed most of the species spawning grounds. The Volgograd dam, built in 1955, has decreased the area of available spawning grounds by 88-100% in the Volga river, similar areas have been reduced in the Terek and Sulak rivers from 132 ha and 202 ha, respectively. The Don river dam removed 68,000 ha of spawning ground and flow regulation in the Kuban river led to the loss of 140,000 ha (CITES 2000).

Due to the longevity of the species there is evidence of pesticide contamination, leading to many problems including reduced reproductive success (Gessner, J. pers comm.).

The Allee effect could also be a threat to the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sturgeon have survived since the time of the dinosaurs but some populations of the beluga are today threatened with commercial extinction, principally as a result of overfishing (9). The eggs are highly prized as caviar, for both their quality and quantity (4). The beluga is the most famous of the caviar sturgeons, and is featured in the Guinness Book of Records as the most expensive fish (3). Previously effective management of Caspian Sea fisheries have recently collapsed and illegal fishing is now rife; the U.S Fish and Wildlife Service estimated in 1998 that more than 50% of worldwide caviar trade was illegal (9). In addition, habitat destruction through the pollution of coastal habitats and the alteration of river systems through dams, pollution and silting have further affected beluga numbers (4). The Volgograd Dam for example, has blocked almost all beluga spawning grounds (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species was listed on CITES Appendix II in 1998. Restocking programmes are ongoing. However the programmes do not compensate for the loss of natural reproduction and the populations continue to decline (CITES 2000).

The annual number of fingerlings released into the Volga show 0.4 million in 1951; 13.1 million between 1966-70 (average per year); 19.4 million between 1981-85; 11.3 million between 1996-2000; and 3 million between 2001-2005 (Khodorevskaya et al. 2009). The Report of the 28th Session of Caspian Bioresource Commission states that the total fingerling release of beluga in 2008 was 7.02 million from Russia, Iran and Khazakstan.

Some natural reproduction of the species remains in the Volga and Ural Rivers. However, at present the abundance of Beluga is extremely low. Since 2000 in Russia, it has only been caught for the purposes of reproduction (for hatcheries) and science. The protective measures at the feeding grounds are necessary to maintain the population of beluga, as well as the preservation of natural spawning and juveniles breeding at hatcheries.

In the Danube the release of recruitment size (over 15 cm long) from Romania into the Danube has risen from 12,500 in 2006, to 15,130 in 2007 and 20,000 in 2008 (Suciu pers. comm.).

Iran, in work with the World Bank, are increasing the rate of release of Beluga; in 2003, 6,000 individuals (CWT tagged and visible tagged) were released. The size of the released individuals has been increased from 3-5 g to 10-25 g to increase survival rates (Pourali et al. 2003). Hatchery experts (which are state owned) are given financial incentives upon the delivery of individuals ready to be released. Iran has also developed beluga farming to supply meat and caviar production to minimize the impact to the wild population (Pourkazemi pers. comm.).

The species is not fully protected in any range state, though fishing licences are required in most countries and Iran has banned private sturgeon fisheries. Overall however, enforcement measures seem to be lacking. In 1996, fishing in the open sea for the species was banned through an agreement between the countries bordering the Caspian Sea. Artificial spawning grounds have been attempted below Volgograd dam, which has shown some success (Ruban pers. comm.). In the Sea of Azov commercial fishing was banned in 1986.

Gene banks, DNA and tissue cryopreservation exists in Iran and Russia.

Azerbaijan have voluntarily proposed a zero quota for Caviar export for 2009 to CITES.

Range states are also encouraged to provide protection to the species spawning and feeding grounds.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The Convention on International Trade in Endangered Species (CITES) (7) imposed a six-month ban on sturgeon catches in June 2001, but conservationists are concerned that this has not gone far enough to save the beluga sturgeon (6). The majority of the sturgeon population is now supported artificially (8); hatcheries may be the sole reason belugas still persist in the Caspian Sea (9). The United States is the biggest importer of caviar and the Fish and Wildlife Service is currently considering listing the species under the Endangered Species Act, effectively banning importation (6), but time is running out in the fight to save this ancient fish
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquaculture: commercial; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There is some evidence that PCPs and other dangerous chemicals may be retained with the eggs of beluga sturgeon (Altuf'ev 1997). Small traces of environmental toxins appear in caviar (Boyle 1994). The levels of some of these chemicals were considered high from samples chosen from some major retailers in the U.S. (between 3.17-3.27 ppm of DDT, 410-640 ppb of Arclor 1254, and 2.1 - 2.8 ppm of selenium) but these numbers are lower than United States Food and Drug Administration action levels. It is doubtful that these traces can be harmful to anyone since few individuals consume such large amounts of caviar that the chemicals could accumulate to dangerous levels.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Due to the incredible value of the roe of this species known commercially as beluga caviar - the most expensive food item in the world(Birstein et al. 1998) - this species is among the most sought after naturally available commercial products in the world. Female beluga can produce 12 % of their body weight in caviar and beluga caviar can demand $200/kg. This species has become so depleted that its survival is supported entirely or nearly entirely by hatcheries throughout its limited range (Secor et al. 2000, Khodorevskya 1999). Without natural recruitment, population structure, age composition and genetic diversity of the beluga sturgeon have suffered (Secor et al. 2000, Raspopov 1993).

Most beluga sturgeon were historically found in the Caspian Sea. This sea is fed by over 100 rivers, the most important of these was the Volga in Russia which histrorically supplied 75% of the Caspian Seas's sturgeon catch (Artyukhin 1997, Khodershaya et al. 1997). Of the other rivers, the Ural River is the only remaining free-flowing major river feeding the Caspian. It is also the only such river where beluga sturgeon can reproduce naturally, without the benefits of hatcheries (Khoderoveskya et al. 1997, DeMeulanaer & Raymakers 1996). However, poaching and pollution problems are higher in the Ural than other parts of the sea, and about 50% of spawning grounds are lost there due to sedimentation and heavy agricultural and industrial pollution (Verina and Peseridi 1979).

The illegal catch of sturgeon in the Caspian Sea and Volga River may be ten times greater than the legal catch (TRAFFIC 2000). Poachers are reportedly removing half of the mature beluga individuals every year. From December 1995 to December 2000 U.S. Fish and Wildlife Services confiscated 3044.19 kg of illegally imported eggs of Huso huso (calculated from USFWS LEMIS system). With an average spawning size of Huso huso individuals being 70 kg (Khodorevskya 1999) and a gonadosomatic index (GSI) ranging from .07-.15 the number of individuals killed to obtain this caviar is between 290 to 621.

Because of the unsupportable demand for caviar, beluga sturgeon are being caught at ages closer and closer to sexual maturity. More than 80% of spawning females are between 17 and 29 years of age, and nearly 90% of males are between 11 and 23 years of age (Raspopov 1993, Rospopov and Novikova 1997). With proper management it is said that it may take between 40 to 45 years for stocks in the Caspian Sea just to return to stable levels (Artyukhin 1997). The slow maturation of sturgeon tied with low numbers have placed estimates of population recovery for some species at more than a century (Secor and Waldman 1999).

Positive Impacts: food ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Beluga (sturgeon)

The beluga /bəˈlɡə/ or European sturgeon (Huso huso) is a species of anadromous fish in the sturgeon family (Acipenseridae) of order Acipenseriformes. It is found primarily in the Caspian and Black Sea basins, and occasionally in the Adriatic Sea. Heavily fished for the female's valuable roe—known as beluga caviar— the beluga is a huge and late-maturing fish that can live for 118 years.[2] The species' numbers have been greatly reduced by overfishing and poaching, prompting many governments to enact restrictions on its trade. The most similar to the Huso huso beluga is the Huso dauricus kaluga, also referred to as the "river beluga".

The common name for the sturgeon, as for the unrelated beluga whale, is derived from the Russian word белый (belyy), meaning "white".

A 1000-kg, 4.17-m long beluga fish from the Volga river (National Museum of Tatarstan, Kazan, Russia)

Contents

Behavior

The beluga is a large predator which feeds mostly on fish. Fish up to 40 pound are ingested. They also eat waterfowl and seal pups. Due to its aggressive behavior and large mouth, it is a potential man-eater, but no attacks have been confirmed.

As do many sturgeons, the beluga travels upstream in rivers to spawn. Accordingly, sturgeons are sometimes likened to sea fish; however, most scientists consider them to be river fish.

Size

The largest generally accepted record is of a female taken in 1827 in the Volga estuary at 1,571 kg (3,460 lb) and 7.2 m (24 ft). Several other records of aged sturgeon exceed 5 m (16 ft).[3] These great sizes mark the beluga as the largest freshwater fish in the world, and as a rival in size to the ocean sunfish among all extant bony fishes. The Beluga also beats the Great White Shark, the Greenland shark, and the Tiger Shark for the title of largest predatory fish. The giant belugas are much larger than the Mekong giant catfish or the arapaima. Nevertheless, some scientists still consider the Mekong giant catfish to be the largest true freshwater fish, owing to sturgeons' ability to survive in seawater and that it spends much of its life in brackish environments.[3]

Beluga of such great sizes are always very old (continuing to grow throughout life) and have become increasingly rare in recent decades due to the heavy fishing of this species. Today, belugas that are caught are generally 142–328 cm (4.66–10.76 ft) long and weigh 19–264 kg (42–580 lb). The female beluga is typically 20% larger than the male.[4]

Uses

Beluga caviar is considered a delicacy worldwide.[5] The flesh of the beluga, on the other hand, is not particularly renowned. Beluga caviar has long been scarce and expensive. The endangered status of the fish has made its caviar more expensive than before.

This fish is used as a pond fish, but is obviously suited only to the largest.

Its air bladder is said to make the best isinglass.[6]

Status

IUCN classifies the beluga as critically endangered. It is a protected species listed in appendix III of the Bern Convention, and its trade is restricted under CITES appendix II. The Mediterranean population is strongly protected under appendix II of the Bern Convention, prohibiting any intentional killing of these fish.

The United States Fish and Wildlife Service has banned imports of beluga caviar and other beluga products from the Caspian Sea since October 6, 2005 after listing beluga sturgeon under the U.S. Endangered Species Act.[7]

References

  1. ^ Sturgeon Specialist Group (1996). "Huso huso". IUCN Red List of Threatened Species. Version 2009.1. International Union for Conservation of Nature. Retrieved 28 October 2009. 
  2. ^ Huso huso. Fishbase.com. Accessed on 11 January 2008
  3. ^ a b Wood, The Guinness Book of Animal Facts and Feats. Sterling Pub Co Inc (1983), ISBN 978-0-85112-235-9
  4. ^ "Huso huso". caspianenvironment.org. 2011. 
  5. ^ "Beluga Caviar". Food Fancy. September, 2012. 
  6. ^  "Huso". Collier's New Encyclopedia. 1921. 
  7. ^ "Beluga Sturgeon Threatened With Extinction, Yet Caviar Quotas Remain Unchanged". Science Daily. March 4, 2008. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!