Overview

Comprehensive Description

Biology

Inhabits sandy and muddy bottoms in flowing pools and runs of headwaters creeks and small to medium rivers. Often found in intermittent streams.
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

his species' range includes southern California coastal drainages; it is native to the Los Angeles, San Gabriel, San Luis Rey, Santa Ana, and Santa Margarita rivers and Malibu and San Juan creeks; successfully introduced in the Santa Ynez, Santa Maria, Cuyama, and other small coastal streams (e.g., Arroyo Grande Creek), and in the Mohave River drainage (Death Valley basin), California (Moyle et al. 1989, Moyle 2002, Page and Burr 2011). This species is now absent from much of the native range, it is abundant only in the upper Santa Margarita River and its tributary De Luz Creek; Trabuco Creek below O'Neill Park; and San Juan creek (San Juan Creek drainage), Malibu Creek, and West Fork of the upper San Gabriel River below Cogswell Reservoir (Moyle 2002). The species also occurs (but is scarce) in several additional drainages (Moyle 2002).

Extent of occurrence is roughly 20,000 square kilometres.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

endemic to a single state or province

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (5000-200,000 square km (about 2000-80,000 square miles)) Range includes southern California coastal drainages; this species is native to the Los Angeles, San Gabriel, San Luis Rey, Santa Ana, and Santa Margarita rivers and Malibu and San Juan creeks; successfully introduced in the Santa Ynez, Santa Maria, Cuyama, and other small coastal streams (e.g., Arroyo Grande Creek), and in the Mohave River drainage (Death Valley basin), California (Moyle et al. 1989, Moyle 2002, Page and Burr 2011). This species is now absent from much of the native range, it is abundant only in the upper Santa Margarita River and its tributary De Luz Creek; Trabuco Creek below O'Neill Park; and San Juan creek (San Juan Creek drainage), Malibu Creek, and West Fork of the upper San Gabriel River below Cogswell Reservoir (Moyle 2002). The species also occurs in (but is scarce) in several additional drainages (Moyle 2002).

Extent of occurrence is roughly 20,000 square kilometers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: Malibu Creek, Santa Clara, San Luis Rey and Santa Margarita River drainages in southern California, USA.
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

California, U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 30 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 400 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

40.0 cm TL (male/unsexed; (Ref. 5723)); max. reported age: 4 years (Ref. 12193)
  • Hugg, D.O. 1996 MAPFISH georeferenced mapping database. Freshwater and estuarine fishes of North America. Life Science Software. Dennis O. and Steven Hugg, 1278 Turkey Point Road, Edgewater, Maryland, USA. (Ref. 12193)
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Habitat includes headwaters, creeks, and small to medium rivers, often intermittent streams (Page and Burr 2011); permanent, small to moderate-sized, moderate to high gradient streams with more than 50% of the habitat as runs and pools.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Habitat includes headwaters, creeks, and small to medium rivers, often intermittent streams (Page and Burr 2011); permanent, small to moderate-sized, moderate to high gradient streams with more than 50% of the habitat as runs and pools < 10 cm deep and reaches of permanent water more than 2 km long; requires some flow. In natural habitat prefers slow moving sections of streams with sand or mud substrate. Midwater and benthic, becomes increasingly secretive with age. Physiologically adapted to hypoxic conditions and wide temperature fluctuations (Castleberry and Cech 1986). Spawns usually in stream pools.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Aquatic insects, snails, and (mostly) algae. Feeds most abundantly on invertebrates in spring, least in winter (Moyle 1976). Diet includes physids, pelecypods, Euparypus, Heliopsyche; apparently seeks mollusks associated with the bottom (Richards and Soltz 1986); also knwon to feed extensively on the roots of a floating water fern infested with nematodes (Moyle 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 6 - 20

Comments: This species is represented by at least 7 native populations and several additional populations outside the native range (Moyle 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

2500 - 10,000 individuals

Comments: Total adult population size is unknown but may not exceed 10,000. Within the native range, the species is common at only four locations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Spawns March-May (Moyle 1976, Lee et al. 1980), March-April according to Moyle et al. (1989). Lives 3-4 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gila orcuttii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTTGTATTTGGTGCCTGAGCAGGAATGGTGGGAACCGCTTTAAGCCTCCTAATTCGGGCCGAATTAAGCCAACCCGGGTCACTCCTAGGCGATGACCAAATTTATAATGTTATCGTTACCGCCCATGCCTTCGTTATAATTTTCTTTATAGTAATGCCAATTCTCATTGGGGGATTCGGAAATTGACTCGTCCCTCTGATAATTGGCGCACCTGATATAGCATTCCCCCGGATAAATAATATAAGTTTCTGGCTTCTTCCTCCATCATTCCTTCTATTATTAGCCTCTTCTGGCGTTGAGGCGGGGGCTGGGACAGGATGAACGGTATACCCCCCACTCGCAGGCAACCTGGCCCATGCGGGGGCCTCAGTAGATCTAACAATTTTCTCATTACATCTGGCAGGTGTCTCATCAATCTTAGGGGCGGTAAACTTTATTACCACAATTATTAATATAAAACCCCCAGCCATTTCCCAATACCAAACACCCCTCTTCGTATGGGCCGTACTTGTAACAGCCGTTCTTCTTCTCTTATCATTACCAGTGCTGGCTGCCGGAATTACAATGCTTCTTACCGATCGAAATCTTAATACCACATTCTTTGACCCGGCAGGGGGAGGAGACCCTATTCTATATCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gila orcuttii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
B1ab(ii,iii,v)+2ab(ii,iii,v)

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
This species is listed as Vulnerable because its extent of occurrence may not exceed 20,000 sq km, area of occupancy probably does not exceed 2000 sq km, number of native locations may not exceed 10, and habitat quality/quantity and probably the species' distribution and abundance are declining (probably at a rate of less than 30 percent over 10 years or three generations). Adult population size is probably at least several thousand.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N2 - Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G2 - Imperiled

Reasons: Small range in southern California coastal drainages; range and abundance have been reduced by habitat degradation associated with urbanization and impacts of non-native fish species (ogoing threats) introductions outside the native range have improved the status somewhat, but some introduced populations have been negatively impacted by hybridization.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by at least 7 native populations and several additional populations outside the native range (Moyle 2002).

Total adult population size is unknown but may not exceed 10,000. Within the native range, the species is common at only four locations.

If not for introductions outside the native range, this species would probably be listed as endangered or threatened (Moyle 2002).

Trend over the past 10 years or three generations is uncertain, but distribution and abundance probably are declining. Three generations does not exceed 10 years. Continued habitat degradation and hybridization with other species is only accelerating the decline of this species.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: Trend over the past 10 years or three generations is uncertain, but distribution and abundance probably are declining. Three generations does not exceed 10 years. Continued habitat degradation and hybridization with other species is only accelerating the decline of this species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Most streams in the native range are degraded as a result of their location in the Los Angeles metropolitan area, and chub populations are fragmented and reduced, especially in the low-gradient reaches that were optimal habitat (see Moyle 2002). Some introduced populations (e.g., those in the Cuyama and Mohave rivers) have been negatively impacted by hybridization with other cyprinids and cannot be regarded as secure or genetically pure (Moyle 2002). Introduced Red Shiner may competitively exclude the Arroyo Chub from many areas (Moyle et al. 1989). Arroyo Shiner dramatically increased in abundance in the Santa Margarita River following extreme high flows in 1997-1998, which reduced the abundance of several non-native fish species. Negative impacts of non-native species, combined with continued degradation of urbanized streams, mean that this species is not secure (Moyle 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vulnerable (VU) (B1ab(ii,iii,v)+2ab(ii,iii,v))
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Most streams in the native range are degraded as a result of their location in the Los Angeles metropolitan area, and chub populations are fragmented and reduced, especially in the low-gradient reaches that were optimal habitat (see Moyle 2002). Some introduced populations (e.g., those in the Cuyama and Mohave rivers) have been negatively impacted by hybridization with other cyprinids and cannot be regarded as secure or genetically pure (Moyle 2002). Introduced red shiner may competitively exclude the arroyo chub from many areas (Moyle et al. 1989). Arroyo shiner dramatically increased in abundance in the Santa Margarita River following extreme high flows in 1997-1998, which reduced the abundance of several non-native fish species. Negative impacts of non-native species, combined with continued degradation of urbanized streams, mean that this species is not secure (Moyle 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Moyle et al. (1989) recommended that status surveys be made annually in the native range, every five years elsewhere. At least three streams in L.A. basin with this and other native fish need to be preserved for native fishes; the West Fork of the San Gabriel River is the strongest candidate for a native fish refuge (Moyle et al. 1989).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biological Research Needs: Determine extent of hybridization in Mohave and other rivers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: None. No occurrences appropriately protected and managed

Needs: At least three streams in L.A. basin with this and other native fish need to be preserved for native fishes; the West Fork of the San Gabriel River is the strongest candidate for a native fish refuge (Moyle et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Arroyo chub

The arroyo chub (Gila orcuttii) is a cyprinid fish found only in the coastal streams of southern California, United States.

The shape of the arroyo chub is somewhat chunky, with a deep body and thick caudal peduncle. The eyes are larger than average for cyprinids. Coloration ranges from silver to gray to olive green above, shading to white below, usually with a dull gray band along each side. The dorsal fin has 8 rays, while the rounded anal fin has 7. Males have larger fins than females, and, during the breeding season, patches of breeding tubercles on the upper surfaces of the pectoral fins. This is a small fish, with most adults in the 7–10 cm length range, and a maximum of 12 cm.

Omnivorous, their diet includes algae, insects, and crustaceans. Studies of fish from warmwater streams shows a preponderance of algae in the stomach (60-80%), and they are also known to feed on the roots of Azolla (floating water ferns). In cooler streams, molluscs and caddisfly larvae predominate in the diet.

Arroyo chub habitat is primarily the warm streams of the Los Angeles Plain, which are typically muddy torrents during the winter, and clear quiet brooks in the summer, possibly drying up in places. They are found both in slow-moving and fast-moving sections, but generally deeper than 40 cm.

They are native to Los Angeles, Santa Margarita, San Gabriel, San Luis Rey, and Santa Ana Rivers, as well as to Rainbow, Temecula, Malibu and San Juan Creeks. Many of the original populations have been extirpated, but it has recently been reestablished in the Arroyo Seco (Los Angeles County), a tributary of the Los Angeles River. It has been found in the Los Angeles River (Sepulveda Dam Basin) as recently as 1978. The species also has been successfully introduced in a number of other rivers in the area, and can be found as far north as Chorro Creek in San Luis Obispo County, and as far east as the Mojave River. The Mojave and Cuyama River populations extend into the ranges of related fishes, and hybridize with Mojave chub and California roach, respectively.

The species epithet was chosen in honor of C. R. Orcutt, who in 1889 made the first collection of this fish, improvising by using a blanket as a seine. It is often misspelled as orcutti, although this is still considered a valid synonym, and is for instance used by Moyle in his book.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Hybridizes with G. bicolor mohavensis and with Lavinia symmetricus under stressed conditions (Lee et al. 1980). Placed with the closely related G. purpurea in the subgenus Temeculina.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!