Overview

Comprehensive Description

Biology

Inhabits flowing pools of creeks and small rivers, usually near brush or other cover.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (5000-20,000 square km (about 2000-8000 square miles)) This species is restricted to tributaries of the endorheic Guzmán basin, including the Mimbres River (Sublette et al. 1990) in New Mexico and the Guzmán and Laguna Bustillos basins in Chihuahua, Mexico (Propst and Stefferud 1994, Page and Burr 2011).

Surveys throughout the historical range by Propst and Stefferud (1994) yielded the following results:

LAGUNA BUSTILLOS BASIN (CHIHUAHUA): At 10 sampled sites, Chihuahua chub was common at only two sites.

GUZMAN BASIN (CHIHUAHUA): At nine sampled sites in the Río Santa Clara, Chihuahua chub was moderately common in the upper portion of the river but uncommon or rare downstream. In the Río de Santa Maria, Chihuahua chub was present at all riverine sites upstream of Presa el Tintero, and moderately common at 2 of 12 sampled sites. In the Río Casas Grande, G. nigrescens was present at three stream sites and a spring system (of a total of 8 sampled sites), and moderately common near Zaragoza and El Rusio. In the Río Piedras Verdes, the species was present at two of four sampled sites (common only near Hernández Jovales). In the Río San Pedro, Chihuahua chub was present at three of four sampled sites (moderately common at one site).

MIMBRES RIVER (NEW MEXICO): Sampling in 21 locations in the Mimbres River and four tributaries yielded Chihuahua chubs in the Mimbres River from the confluence of Allie Canyon downstream for about 12 km and in Archuleta/Moreno Spring; the species was not collected at all sites in the occupied reach nor was it common where found; Archuleta/Moreno Spring supported the greatest number of individuals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: Mimbres River in New Mexico, USA and also in Lagunas Guzman and Bustillos, Chihuahua in Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
U.S.A. (NM), Mexico (Chihuahua)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

New Mexico, U.S.A., and Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 20 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 240 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

24.0 cm TL (male/unsexed; (Ref. 5723))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Syntype for Gila nigrescens
Catalog Number: USNM 219
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): C. Kennerly
Year Collected: 1855
Locality: Espia, Mexico (Janos River)., Mexico, North America
  • Syntype: Girard, C. F. 1857. Proceedings of the Academy of Natural Sciences of Philadelphia. 8: 207.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Gila nigrescens
Catalog Number: USNM 220
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Dry Osteological Specimen
Collector(s): C. Kennerly
Year Collected: 1854
Locality: Boca Grande, Chihuahua, Mexico, North America
  • Syntype: Girard, C. F. 1857. Proceedings of the Academy of Natural Sciences of Philadelphia. 8: 207.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Gila nigrescens
Catalog Number: USNM 233
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Dry Osteological Specimen; Photograph
Collector(s): J. Clark
Locality: Rio Mimbras, Chihuahua, Mexico, North America
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: "Pristine conditions were clear, flowing streams with riffles, deep pools, sand and gravel substrates with algae-covered rocks, large boulders, and crevices in canyon walls" (Miller 2005). These fishes are most often in flowing pools of shallow creeks and small rivers in canyons, but they can survive and reproduce in isolated pools. Typically they occur in association with cover such as submerged or overhanging trees, boulders, or undercut banks, over a substrate of sand, gravel, and cobble with some occasional fine mud or silt. Habitat is subject to extreme drying in summer and flash floods in rainy season. Spawning occurs over beds of aquatic vegetation in deep quiet pools (Matthews and Moseley 1990). Juveniles tend to occupy shallower habitats with or without cover.

Propst and Stefferud (1994) found Chihuahua chubs most commonly over gravel substrates in lateral scour pools where flow was against and along a stream bank or a partial channel obstruction (boulder, cliff, or root wad). These scour pools were usually 4-7 m long, 1-2 m wide, and about 1 m deep. Water velocity was usually not more than 15 cm/s; although immediately adjacent velocity was often not more than 60 cm/s. Corner and backwater pools, both with woody material, yielded most of the remaining specimens. Larger specimens (at least 100 mm) were almost exclusively in lateral-scour pools, particularly those formed by root masses of uprooted and standing trees. Smaller individuals were in corner pools and backwaters only when chubs were abundant at a site. Almost all macrohabitats having chubs were characterized by extensive cover composed of snags and organic debris or root masses of large trees. Chihuahua chubs were rare or absent where non-native fishes (particularly potential predators) were common.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Pristine conditions were clear, flowing streams with riffles, deep pools, sand and gravel substrates with algae-covered rocks, large boulders, and crevices in canyon walls (Miller 2005). These fishes are most often in flowing pools of shallow creeks and small rivers in canyons, but they can survive and reproduce in isolated pools. Typically they occur in association with cover such as submerged or overhanging trees, boulders, or undercut banks, over a substrate of sand, gravel, and cobble with some occasional fine mud or silt. Habitat is subject to extreme drying in summer and flash floods in rainy season. Spawning occurs over beds of aquatic vegetation in deep quiet pools (Matthews and Moseley 1990). Juveniles tend to occupy shallower habitats with or without cover.

Propst and Stefferud (1994) found Chihuahua Chubs most commonly over gravel substrates in lateral scour pools where flow was against and along a stream bank or a partial channel obstruction (boulder, cliff, or root wad). These scour pools were usually 4–7 m long, 1–2 m wide, and about 1 m deep. Water velocity was usually not more than 15 cm/s; although immediately adjacent velocity was often not more than 60 cm/s. Corner and backwater pools, both with woody material, yielded most of the remaining specimens. Larger specimens (at least 100 mm) were almost exclusively in lateral-scour pools, particularly those formed by root masses of uprooted and standing trees. Smaller individuals were in corner pools and backwaters only when chubs were abundant at a site. Almost all macrohabitats having chubs were characterized by extensive cover composed of snags and organic debris or root masses of large trees. Chihuahua Chubs were rare or absent where non-native fishes (particularly potential predators) were common.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Takes insects from water surface; feeds also on small aquatic invertebrates, fish fry, and some plant matter (Matthews and Moseley 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 6 - 20

Comments: This species is represented by one occurrence (subpopulation) in New Mexico and several in Chihuahua (Propst and Stefferud 1994).

In a range-wide survey, Propst and Stefferud (1994) found Chihuahua chubs at 28 of 40 stream sites having fish, in one of nine spring sites, and at neither of two lakes sampled in Chihuahua. It was moderately common at 12 of the stream sites, but fewer than 30 chubs were collected at six of these. In the Mimbres Drainage, the Chihuahua chub was regularly found only in Archuleta/Moreno Spring and was not common there. [Note: a distinct occurrence or subpopulation may comprise multiple "sites."]

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

1000 - 10,000 individuals

Comments: Total adult population size is unknown but, based on the results of surveys by Propst and Stefferud (1994), may not exceed 10,000. At best, the New Mexico population has remained stable at about 200 to 300 mature individuals (New Mexico Department of Game and Fish, 1996, Endangered Species of New Mexico -- 1996 Biennial Review and Recommendations). As of the mid-1990s, the adult population in New Mexico had increased to 300 and occupied a reach of about 11 km of the Mimbres River (D. Propst, pers. comm., 1995). Abundance in Mexico is unknown, but the species is not common in most of the historical range (Propst and Stefferud 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Spawning may occur over a protracted period (early spring through early autumn) or may be bimodal in spring and summer (Propst and Stefferud 1994, Miller 2005). Sexually mature probably in about 1 year (see Sublette et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gila nigrescens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTTGTATTCGGTGCCTGAGCAGGAATGGTGGGAACCGCCCTAAGCCTCCTAATTCGGGCCGAATTAAGCCAACCCGGGTCACTCCTAGGTGATGACCAAATTTATAATGTTATCGTTACCGCCCATGCCTTCGTTATAATTTTCTTTATAGTAATGCCAATTCTTATCGGGGGATTCGGAAATTGACTCGTCCCTCTAATAATTGGCGCACCTGATATAGCATTCCCACGAATAAATAACATAAGTTTCTGGCTTCTTCCCCCATCGTTCCTCTTACTATTAGCCTCTTCTGGCGTTGAGGCCGGGGCTGGGACAGGGTGAACAGTATATCCCCCACTCGCAGGCAACCTAGCTCACGCGGGGGCATCAGTAGACCTAACAATCTTCTCACTACATCTGGCGGGTGTCTCATCAATTTTAGGGGCAGTAAACTTTATCACCACAATTATTAATATAAAACCCCCAGCCATTTCCCAATACCAAACACCCCTCTTCGTATGGGCCGTACTTGTAACAGCCGTTCTTCTTCTTTTATCACTACCAGTGCTGGCTGCCGGAATTACAATGCTTCTTACCGATCGAAACCTTAACACCACATTCTTTGACCCGGCAGGGGGAGGAGACCCCATTTTATACCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gila nigrescens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N1 - Critically Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G1 - Critically Imperiled

Reasons: Small range in Chihuahua and New Mexico; has declined dramatically in both range and abundance; declines in Mexico probably are continuing; threatened by habitat loss/degradation (e.g., dewatering, channelization, pollution of streams) and effects of non-native fishes.

Intrinsic Vulnerability: Moderately vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
B1ab(ii,iii,iv,v)+2ab(ii,iii,iv,v)

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
This species is listed as Vulnerable because its extent of occurrence is less than 20,000 sq km, area of occupancy is apparently less than 500 sq km, the species occurs in possibly not more than 10 locations, and distribution, abundance, and habitat quality/quantity are declining (probably at a rate of less than 30 percent over 10 years or three generations). Population size is unknown. Distribution may not be severely fragmented. The species might qualify as a threatened species under criterion A, but current rate of decline is uncertain.

History
  • 1996
    Critically Endangered
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Threatened
Date Listed: 10/11/1983
Lead Region:   Southwest Region (Region 2) 
Where Listed: Entire


Population detail:

Population location: Entire
Listing status: T

For most current information and documents related to the conservation status and management of Gila nigrescens , see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: Current trend is uncertain, but distribution and abundance probably are slowly declining. Generation time is uncertain, but three generations may not exceed 10 years.

Propst and Stefferud (1994) stated that loss of the native aquatic biodiversity in the area occupied by Chihuahua chubs seems likely to continue. Propst and Stefferud (1994) projected the trend as follows: "Stream dewatering and habitat destruction may soon cause extirpation of Chihuahua chub from limited habitats of the Laguna Bustillos Basin. In the Guzmán basin, Chihuahua chub may survive only in remote reaches of the rios Santa Clara, Santa Maria, Casas Grandes, and Piedras Verdes. Even in these areas, threats continue from non-native species, pollution, uncontrolled logging, and overharvest. The future of the Chihuahua chub is bleak."

Ash-laden flows from the 1995 "Pigeon Fire" substantially reduced Chihuahua chub abundance in the Mimbres River. The surviving river population was probably supplemented by individuals leaving the Moreno Spring (New Mexico Department of Game and Fish, September 2000 Biennial Review and Recommendations).

Global Long Term Trend: Decline of 50-70%

Comments: The species was relatively abundant in 1884; reported extinct by 1938; rediscovered in 1975. Miller and Chernoff (1979) sampled sites of historical occurrence and found it at only 8 of 16 historical collection localities, and it was common at only three. USFWS (1990) categorized the status as "stable." Propst and Stefferud (1994) surveyed historical collection sites and other areas in the historical range. They concluded that both range and abundance have declined dramatically in the past century. Miller (2005) reported that "this species has been eliminated over the past 35 years from at least half its original range."

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by one occurrence (subpopulation) in New Mexico and several in Chihuahua (Propst and Stefferud 1994).

In a range-wide survey, Propst and Stefferud (1994) found Chihuahua Chubs at 28 of 40 stream sites having fish, in one of nine spring sites, and at neither of two lakes sampled in Chihuahua. It was moderately common at 12 of the stream sites, but fewer than 30 chubs were collected at six of these. In the Mimbres Drainage, the Chihuahua Chub was regularly found only in Archuleta/Moreno Spring and was not common there. [Note: a distinct occurrence or subpopulation may comprise multiple "sites."]

Total adult population size is unknown but, based on the results of surveys by Propst and Stefferud (1994), may not exceed 10,000. At best, the New Mexico population has remained stable at about 200 to 300 mature individuals (New Mexico Department of Game and Fish, 1996, Endangered Species of New Mexico -- 1996 Biennial Review and Recommendations). As of the mid-1990s, the adult population in New Mexico had increased to 300 and occupied a reach of about 11 km of the Mimbres River (D. Propst pers. comm. 1995). Abundance in Mexico is unknown, but the species is not common in most of the historical range (Propst and Stefferud 1994).

The species was relatively abundant in 1884; reported extinct by 1938; rediscovered in 1975. Miller and Chernoff (1979) sampled sites of historical occurrence and found it at only 8 of 16 historical collection localities, and it was common at only three. USFWS (1990) categorized the status as "stable." Propst and Stefferud (1994) surveyed historical collection sites and other areas in the historical range. They concluded that both range and abundance have declined dramatically in the past century. Miller (2005) reported that "this species has been eliminated over the past 35 years from at least half its original range."

Current trend is uncertain, but distribution and abundance are probably slowly declining. Generation time is uncertain, but three generations may not exceed 10 years.

Propst and Stefferud (1994) stated that loss of the native aquatic biodiversity in the area occupied by Chihuahua Chubs seems likely to continue. Propst and Stefferud (1994) projected the trend as follows: "Stream dewatering and habitat destruction may soon cause extirpation of Chihuahua Chub from limited habitats of the Laguna Bustillos Basin. In the Guzmán basin, Chihuahua chub may survive only in remote reaches of the rios Santa Clara, Santa Maria, Casas Grandes, and Piedras Verdes. Even in these areas, threats continue from non-native species, pollution, uncontrolled logging, and overharvest. The future of the Chihuahua Chub is bleak."

Ash-laden flows from the 1995 "Pigeon Fire" substantially reduced Chihuahua Chub abundance in the Mimbres River. The surviving river population was probably supplemented by individuals leaving the Moreno Spring (New Mexico Department of Game and Fish, September 2000 Biennial Review and Recommendations).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Very high - high

Comments: Development of water resources for agricultural and municipal uses has dewatered the downstream ends of streams, and surface flow is now seasonally diminished where water was historically permanent (Brand 1937). By the 1950s, upland streams in the range of the Chihuahua chub were severely damaged by the effects of uncontrolled logging and pollution from sawmills; harvest of fish with dynamite depleted surviving fish populations (Needham and Gard 1959).

Currently, the Chihuahua chub is limited to stream reaches where modification (e.g., channelization and dewatering) and human-induced habitat degradation (e.g., livestock overgrazing, municipal and agricultural pollution) are minimal; such areas are uncommon (Miller and Chernoff 1979, Propst and Stefferud 1994). The presence and abundance of pools associated with root masses of uprooted or standing large trees appeared to be the best predictor of the occurrence and abundance of Chihuahua chubs (Propst and Stefferud 1994). Chubs were moderately common only in remote and relatively unmodified portions of the rios Santa Clara, Santa Maria, and Casas Grandes where mature stands of cottonwood were fairly common. Where cultivated fields bordered the stream or where towns were nearby, large riparian trees were uncommon and no snags or root masses were in the stream; in these areas Chihuahua chubs were uncommon or absent and individuals were small (Propst and Stefferud 1994). Additionally, Chihuahua chubs were also uncommon where non-native fishes were present, even if habitat was not degraded.

Reasons for its decline in New Mexico include modification of habitat by agricultural and flood control practices, and establishment of non-native fish species (USFWS 1983, Propst and Stefferud 1994). Severe modification and destruction of riverine habitats (dewatering, channelizing, and removal of woody riparian vegetation) are the greatest threats and impediments to recovery in the Mimbres River. Sections of the Mimbres River that historically contained pools and flowing water are now usually dry. Severe flooding caused by degradation of the watershed (e.g., deforestation and consequent erosion, siltation, and water temperature alteration), and loss of riparian vegetation have contributed to the decline. Nonnative fishes such as rainbow trout usurp Chihuahua chub habitat and may prey upon them. Longfin dace (Agosia chrysogaster) may displace young Chihuahua chub from shoreline habitats. The yellow grub infestation of chubs in Moreno Spring presents a severe health threat to this population (New Mexico Department of Game and Fish, September 2000 Biennial Review and Recommendations).

In Chihuahua, water quality degradation (pollution), surface water diversion for irrigation, groundwater pumping (and subsequent drying up of springs), stream channelization, and introduction of non-native fishes have contributed to the decline (Miller and Chernoff 1979, Propst and Stefferud 1994). Miller and Chernoff (1979) reported habitat conditions in Chihuahua, Mexico, as follows. The Rio Casas Grandes about 21 km southwest of Ascension was badly polluted; the pools were stagnant and choked with Spirogyra and other algae; flow was minimal and riffles were absent (this leads to reduced dissolved oxygen). In the Rio Casas Grandes just east of Casas Grandes proper, the river was sluggish, murky, strewn with trash, and choked with Spirogyra and narrow-leafed Potamogeton. In the Rio San Miguel at Ignacio Zaragoza, the river channel has been dredged and levees built. The water at this site was murky, less than 5 cm deep, and without noticeable current. The Rio Santa Maria at Bachiniva was, in places, used as a garbage dump. Water in the Rio del Carmen near Ahumada has been diverted for irrigation and no longer flows in the river channel. The Rio del Carmen near Ricardo Flores Magon was dry due to the presence, about ten kilometers upstream, of an earthen dam and hydroelectric power plant. In the Laguna Bustillos Basin, Arroya Miguel Chiquito was dry and the waters in Arroyo San Antonio were polluted.

A number of exotic fishes have been introduced within the range of Gila nigrescens, including Agosia chrysogaster and Oncorhynchus mykiss in the Mimbres River (USFWS 1986), Cyprinus carpio and Ictalurus melas in Rio Casas Grandes, Ictalurus melas and Ambloplites rupestris in Rio Piedras, Gambusia affinis in Rio Santa Maria near Buenaventura, and Cyprinus carpio in Rio Santa Maria at Santa Ana de Bavicora (Miller and Chernoff 1979). Specific effects of these fishes are not well documented but likely they are detrimental.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Development of water resources for agricultural and municipal uses has dewatered the downstream ends of streams, and surface flow is now seasonally diminished where water was historically permanent (Brand 1937). By the 1950s, upland streams in the range of the Chihuahua Chub were severely damaged by the effects of uncontrolled logging and pollution from sawmills; harvest of fish with dynamite depleted surviving fish populations (Needham and Gard 1959).

Currently, the Chihuahua Chub is limited to stream reaches where modification (e.g., channelization and dewatering) and human-induced habitat degradation (e.g., livestock overgrazing, municipal and agricultural pollution) are minimal; such areas are uncommon (Miller and Chernoff 1979, Propst and Stefferud 1994). The presence and abundance of pools associated with root masses of uprooted or standing large trees appeared to be the best predictor of the occurrence and abundance of Chihuahua chubs (Propst and Stefferud 1994). Chubs were moderately common only in remote and relatively unmodified portions of the rios Santa Clara, Santa Maria, and Casas Grandes where mature stands of cottonwood were fairly common. Where cultivated fields bordered the stream or where towns were nearby, large riparian trees were uncommon and no snags or root masses were in the stream; in these areas Chihuahua Chubs were uncommon or absent and individuals were small (Propst and Stefferud 1994). Additionally, Chihuahua Chubs were also uncommon where non-native fishes were present, even if habitat was not degraded.

Reasons for its decline in New Mexico include modification of habitat by agricultural and flood control practices, and establishment of non-native fish species (USFWS 1983, Propst and Stefferud 1994). Severe modification and destruction of riverine habitats (dewatering, channelizing, and removal of woody riparian vegetation) are the greatest threats and impediments to recovery in the Mimbres River. Sections of the Mimbres River that historically contained pools and flowing water are now usually dry. Severe flooding caused by degradation of the watershed (e.g., deforestation and consequent erosion, siltation, and water temperature alteration), and loss of riparian vegetation have contributed to the decline. Non-native fishes such as rainbow trout usurp Chihuahua Chub habitat and may prey upon them. Longfin Dace (Agosia chrysogaster) may displace young Chihuahua Chub from shoreline habitats. The yellow grub infestation of chubs in Moreno Spring presents a severe health threat to this population (New Mexico Department of Game and Fish, September 2000 Biennial Review and Recommendations).

In Chihuahua, water quality degradation (pollution), surface water diversion for irrigation, groundwater pumping (and subsequent drying up of springs), stream channelization, and introduction of non-native fishes have contributed to the decline (Miller and Chernoff 1979, Propst and Stefferud 1994). Miller and Chernoff (1979) reported habitat conditions in Chihuahua, Mexico, as follows. The Rio Casas Grandes about 21 km southwest of Ascension was badly polluted; the pools were stagnant and choked with Spirogyra and other algae; flow was minimal and riffles were absent (this leads to reduced dissolved oxygen). In the Rio Casas Grandes just east of Casas Grandes proper, the river was sluggish, murky, strewn with trash, and choked with Spirogyra and narrow-leafed Potamogeton. In the Rio San Miguel at Ignacio Zaragoza, the river channel has been dredged and levees built. The water at this site was murky, less than 5 cm deep, and without noticeable current. The Rio Santa Maria at Bachiniva was, in places, used as a garbage dump. Water in the Rio del Carmen near Ahumada has been diverted for irrigation and no longer flows in the river channel. The Rio del Carmen near Ricardo Flores Magon was dry due to the presence, about ten kilometres upstream, of an earthen dam and hydroelectric power plant. In the Laguna Bustillos Basin, Arroya Miguel Chiquito was dry and the waters in Arroyo San Antonio were polluted.

A number of exotic fishes have been introduced within the range of Gila nigrescens, including Agosia chrysogaster and Oncorhynchus mykiss in the Mimbres River (USFWS 1986), Cyprinus carpio and Ictalurus melas in Rio Casas Grandes, Ictalurus melas and Ambloplites rupestris in Rio Piedras, Gambusia affinis in Rio Santa Maria near Buenaventura, and Cyprinus carpio in Rio Santa Maria at Santa Ana de Bavicora (Miller and Chernoff 1979). Specific effects of these fishes are not well documented but likely they are detrimental.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Critically Endangered (CR) (A1ace+2ce, B1+2abc)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: McKnight Creek, below the Gila trout waterfall barrier, has been stocked with Chihuahua chub (1993 and 1997) to increase abundance of stream populations of the species. Individuals were stocked in 1999 and 2000 in Mimbres River downstream of San Lorenzo on TNC properties.

Biological Research Needs: Much remains to be learned about the biology and habitat associations of the Chihuahua chub and its interactions with non-native fishes (Propst and Stefferud 1994).

Populations should be periodically monitored, especially where the species is still relatively common in Chihuahua.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: None. No occurrences appropriately protected and managed

Comments: The New Mexico Department of Game and Fish and The Nature Conservancy have properties on the Mimbres River that were purchased, in part, to provide habitat for the Chihuahua chub (Biota Information System of New Mexico).

Needs: Habitat acquisition/protection, including maintenance or improvement of water quality and quantity, is an important element of the recovery process.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
Much remains to be learned about the biology and habitat associations of the Chihuahua Chub and its interactions with non-native fishes (Propst and Stefferud 1994).

Populations should be periodically monitored, especially where the species is still relatively common in Chihuahua.

Further surveys are needed to determine the status of the species in areas of Chihuahua that have not yet been adequately sampled (Propst and Stefferud 1994).

Habitat acquisition/protection, including maintenance or improvement of water quality and quantity, is an important element of the recovery process.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Harvested for food by Mimbres Indians in centuries past.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Chihuahua chub

The Chihuahua chub, or charalito Chihuahua (Gila nigrescens) is a species of ray-finned fish in the Cyprinidae family. It is found in Chihuahua, Mexico and in New Mexico, United States.

Source[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The taxonomic status and relationships among isolated chub populations in the Laguna Bustillos and Guzmán basins and the Mimbres River need further study (Propst and Stefferud 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!