Overview

Brief Summary

The Pacific hagfish (Eptatretus stoutii) is a species of hagfish. It lives in the mesopelagic to abyssal Pacific ocean, near the ocean floor. It is a jawless fish, a throwback to the Paleozoic Era when fish evolved. Deep-sea diving equipment is known to have been fouled by large amounts of hagfish slime near the bottom of the ocean, extruded by the eel-like fish when they are alarmed.

The hagfish is notorious for its slimy skin. When disturbed, it oozes proteins from slime glands in its skin that respond to water by becoming a slimy outer coating, expanding it into a huge mass of slime. This makes them very unsavory to predators. Hagfish create large amounts of slime in just minutes. One scientist researching this protein excretion concluded that a single hagfish could fill an entire barrel with slime in less than 100 minutes.[1]

In many parts of the world, including the US, hagfish-skin clothing, belts, or other accessories are advertised and sold as "yuppie leather" or "eel-skin"[2] (hagfish are not true eels, which are bony fish with jaws).

The hagfish is eaten in Korea and other Asian countries, along with its eggs and its slime. The section of the fishing industry devoted to hagfish-fishing has grown in recent years.

The hagfish has feelers that enable it to find food more easily. It is an opportunistic feeder, and eats dead and rotting animals that float down from the pelagic zone of the ocean. Swarms of hagfish will descend upon and penetrate the carcass and devour it from the inside out. This mode of marine waste disposal allows the hagfish to efficiently gain nutrients. The resultant rarity of rotting animals on the sea floor is one of the factors that modulates global cycles of phosphorus, carbon and nitrogen.

This fish is often referred to as the "slime eel". This is an incorrect common name / nickname.

From Wikipedia 2013

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© Wikipedia

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Inhabits fine silt and clay bottoms (Ref. 6885). Enters large fishes by way of the mouth and anus and feed on its viscera and muscles (Ref. 6885). May greatly diminish catches taken with fixed gears (Ref. 6885). Produces mucilaginous slime when harassed (Ref. 6885). Probably exhibits hermaphroditism (Ref. 56947). Due to its primitive metabolism it is collected for research purposes (Ref. 6885).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species is found in the Eastern North Pacific, from Nootka Bay, Vancouver, Canada to Pt. San Pablo, Baja California, Mexico. Hart (1973) and Mecklenburg et al. (2002) reported that Alaskan records have not been confirmed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: southeastern Alaska to Bahia San Pablo, central Baja California, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Eptatretus stoutii (Pacific hagfish) are found in cold marine waters of the antitropical north and south Pacific Ocean on muddy sea floors.

Biogeographic Regions: pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Pacific hagfish resemble lampreys, being long, tubular, and pinkish grey in color. They lack fins, except for a primitive tail fin that proves useless for propulsion. Their eyes are small and reduced, but Pacific hagfish have a good sense of smell and touch. Their mouth contains a ring of short and sensitive tentacles. Hagfish do not have true jaws, but instead have two pair of rasps on the tongue used for pulling and tearing. Large slime glands run the length of their body near the degenerate lateral line. Hagfish have a partial skull and cartilagenous skeleton. They are from 30 to 63.5 cm in length and from 0.8 to 1.4 kg. Females are typically larger than males.

Range mass: 0.8 to 1.4 kg.

Range length: 30.48 to 63.5 cm.

Other Physical Features: ectothermic ; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

63.5 cm TL (male/unsexed; (Ref. 96339))
  • Love, M.S., C.W. Mecklenburg, T.A. Mecklenburg and L.K. Thorsteinson 2005 Resource Inventory of Marine and Estuarine Fishes of the West Coast and Alaska: A Checklist of North Pacific and Arctic Ocean Species from Baja California to the Alaska-Yukon Border. U.S. Department of the Interior, U.S. Geological Survey, Biological Resounces Division, Seattle, Washington, 98104. (Ref. 96339)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 468 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

No true fins - one dorsal finfold, far back, median, very low, continuous with caudal; caudal broad, rounded; ventral finfold very low, origin somewhat posterior to last gill pore, extending to anus (Ref. 6885). Dark brown, tan, gray, or brownish red, often tinted with blue or purple, never black, lighter ventrally, rarely with large patches of white; preserved specimens light brown (Ref. 6885).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; non-migratory; marine; depth range 16 - 966 m (Ref. 96339)
  • Love, M.S., C.W. Mecklenburg, T.A. Mecklenburg and L.K. Thorsteinson 2005 Resource Inventory of Marine and Estuarine Fishes of the West Coast and Alaska: A Checklist of North Pacific and Arctic Ocean Species from Baja California to the Alaska-Yukon Border. U.S. Department of the Interior, U.S. Geological Survey, Biological Resounces Division, Seattle, Washington, 98104. (Ref. 96339)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is found on the continental shelves and upper slopes at depths from 16-966 m. Environmental information from Mayne Bay on Barkley Sound, Vancouver Island, indicates that Eptatretus stoutii occurs on substrates consisting mainly by silt and in waters characterized by high near-bottom salinity (31-32‰) but low surface salinity (24‰) into which they occasionally swim (McInerney and Evans 1970).

Based on Oregon hagfish fishery, Barss (1993) sampled 924 Pacific hagfish from commercial and research catches, from 1988 through 1989. Mean length of fish sampled from commercial landings was 39.6cm. Fifty percent maturity for male and female was 35 cm and 42 cm, respectively. Examination of gonads indicates that spawning occurs throughout the year. Mature Pacific hagfish females averaged 28 eggs over 5 mm in length.

Of 309 specimens examined by Howard Ayres, 182 (59%) were males, 121 (39%) females, and six (2%) hermaphrodites (Conel, 1931). Also, of 870 specimens examined by Wisner and McMillan (1990), in which the sex was reliably determined, 51% were male and 49% female. These ratios contrast notably with other eastern Pacific hagfishes, in which females dominated by 60-74%. The largest egg found measured 28.6 x 7.5 mm, obtained from a 435 mm female. The number of developed eggs (20mm or longer) varies from 11 (23 x 7 mm) in a 330 mm female to 48 (20 x 6 mm) in one of 515 mm TL.

This species inhabits fine silt and clay bottoms. It enters large fishes by way of the mouth and anus and feed on its viscera and muscles and may greatly diminish catches taken with fixed gears. This species produces mucilaginous slime when harassed (Hart 1973). The copulatory organ is absent in this species (Patzner 1998).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pacific hagfish are found typically on muddy bottoms to depths of 633 meters, but can also be found occasionally on rocky bottoms. They are more common at shallower depths, from 40 to 100 meters. Pacific hagfish may make small migrations from shallow waters in the fall into deeper water. Although this is unconfirmed, it is consistent with seasonal migrations in other hagfish.

Range depth: 16 to 633 m.

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: benthic

  • Fernholm, B. 1998. The Biology of Hagfishes. London: Chapman & Hall.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 63 specimens in 1 taxon.
Water temperature and chemistry ranges based on 56 samples.

Environmental ranges
  Depth range (m): 27.45 - 837.5
  Temperature range (°C): 4.528 - 8.705
  Nitrate (umol/L): 13.007 - 43.616
  Salinity (PPS): 32.561 - 34.425
  Oxygen (ml/l): 0.303 - 5.506
  Phosphate (umol/l): 1.398 - 3.485
  Silicate (umol/l): 21.984 - 108.439

Graphical representation

Depth range (m): 27.45 - 837.5

Temperature range (°C): 4.528 - 8.705

Nitrate (umol/L): 13.007 - 43.616

Salinity (PPS): 32.561 - 34.425

Oxygen (ml/l): 0.303 - 5.506

Phosphate (umol/l): 1.398 - 3.485

Silicate (umol/l): 21.984 - 108.439
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 16 - 633m.
From 16 to 633 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Pacific hagfish have two pair of primitive, yet effective, rasps on the tongue used primarily for grasping. After establishing a firm hold on a food source, the hagfish ties and unties a knot within its own body to generate a ripping force. Pacific hagfish feed on a variety of dead or dying organisms, including fish and mammals, but also probably include marine invertebrates in their diet. Male hagfish may eat hagfish eggs.

Animal Foods: mammals; fish; eggs; carrion ; aquatic or marine worms; other marine invertebrates

Primary Diet: carnivore (Scavenger )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Pacific hagfish are crucial for eliminating dead and dying organsims, and the effect of large-scale removal on the ecosystem could be significant as hagfish are important for recycling nutrients.

Ecosystem Impact: biodegradation ; parasite

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Pacific hagfish produce large amounts of mucilaginous slime, and can tie and untie knots in their body to evade predators. The primary predators of Pacific hagfish are harbor seals (Phoca vitulina) and humans. They have also been found in the stomachs of sablefish (Anoplopoma fimbria).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

A system of sensory organs resembling taste buds, called Schreiner organs, are found throughout the epidermis. The distribution of these organs is more extensive than taste buds in nearly any vertebrate, giving hagfish the ability to sense prey in dark and muddy habitats. This sensory system has no direct homologue in vertebrates and seems specific to hagfish. Hagfish also have well-developed nasal organs used in olfaction.

Perception Channels: chemical

  • Braun, C. 1998. Schreiner Organs: A new Craniate Chemosensory Modality in Hagfishes. J Comp Neurol., March 9;392(2): 135-163.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Copulatory organ absent (Ref. 51361). Presence of bisexual juvenile gonad, requires further investigation regarding hermaphroditism (Ref. 56947). In one study (Ref. 40710), hermaphroditism is exhibited by only 0.2% of the individuals studied.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Development

Pacific hagfish hatch from an egg in fully functional form without any intermediate larval stage. Determining the sex of Pacific hagfish below 35 cm in length is difficult as a copulatory organ is absent. Despite over a century of searching, only 200 fertilized eggs of Eptatretus stoutii have been found in Monterey Bay, California.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Estimated life span of Pacific hagfish in the wild is 40 years, and 17 years in captivity.

Typical lifespan

Status: wild:
40 (high) years.

Typical lifespan

Status: captivity:
17 (high) years.

  • King, J., G. McFarlane. 2003. Marine Fish Life History Strategies: Applications to Fishery Management. Fisheries Management & Ecology, 10: 249-264.
  • Finch, C. 1990. Longevity, Senescence, and the Genome. Chicago: University of Chicago Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Hagfish reproduction is poorly understood, but evidence has been found indicating sequential hermaphroditic periods thought to arise from population pressures.

Sexes are separate, but hermaphroditic adults can be found. No specific spawning season has been identified as males and females are found at various maturation stages throughout the year. Some females have been found with distinctly separate egg batches in them. Smaller sized egg batches do not develop further until the larger batch has completed development. From 20 to 30 eggs are usually deposited at a time. Eggs have been found at depths of 15 to 25 meters. Age is difficult to determine, as hagfish have a cartilagenous skeleton.

Breeding interval: Breeding intervals are unknown, but there is some evidence that individuals breed once yearly.

Breeding season: There is no evidence of a breeding season.

Range number of offspring: 20 to 30.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); sequential hermaphrodite; sexual ; oviparous

Pacific hagfish hatch into fully functional, small hagfish. There is no parental involvement after egg-laying.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eptatretus stoutii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAATTTTTGGTGCATGAGCCGGAATAATCGGAACAGCTTTAAGTGTAATTATTCGAACAGAATTAAGCCAACCAGGGCCCTTAATTAACAATGACCAACTTTATAATACAATCATCACAGCCCATGCATTCATTATAATTTTCTTCATAGTTATACCAATTATAATTGGTGGTTTTGGAAACTGACTAGTACCATTAATAATTGGTGCACCAGATATAGCATTCCCACGAATAAACAATATAAGCTTTTGACTTCTTCCACCTTCACTCCTTCTTCTACTTTCATCTTCCATAATTAGTTCTGGTGCAGGAACTGGGTGAACTGTTTACCCACCCCTTTCAAATCATATTTCACATATAGGCCCATCAGTAGATTTAACTATTTTCTCACTACACCTAGCAGGTGTTTCTTCCATTTTAGGAGCAATCAACTTTATCACTACTATTATCAACATAAAAATACAATCAATAACCATATATCACATCCCATTATTTGTATGATCAATCCTAATCACCACAATTTTACTTCTCCTTTCCCTGCCAGTTTTAGCTGCTGCCATCACTATACTACTTACTGATCGTAATCTCAATACTACCTTTTTTGATCCTTCTGGTGGAGGAGATCCTATCCTTTATCAACACCTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eptatretus stoutii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Mincarone, M.M.

Reviewer/s
Polidoro, B., Knapp, L. & Carpenter, K.E.

Contributor/s

Justification
This species is only known from the northeastern Pacific, where it is heavily targeted in at least half of range for the Asian eel-skin leather market. Reported landings for this species are mixed with the Black Hagfish (E. deani) and have been quite variable in both total catch and effort over the past 20 years (1988-2007). The reasons for the variability in catch and effort trends are not well understood. This species is therefore currently listed as Data Deficient. More research is needed to quantify the impacts of fishing on this species population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pacific hagfish remain common throughout their range.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is known to be abundant across its distribution range. It is known to be most abundant off the coast of Northern California and Oregon.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species is targeted in trap fisheries along the west coast of North America for the Asian leather market. Whole frozen fish are shipped to South Korea for the eel skin leather market.

In 1988, the Oregon Department of Fish and Wildlife began sampling and monitoring the development of a new fishery for Pacific Hagfish (Eptatretus stoutii) and Black Hagfish (E. deani) (Barss 1993). Hagfish landings by Oregon trap vessels ranged from 11 metric tonnes in 1988 to a peak of 340 metric tonnes in 1992. In the 1988 catch, about 35% (4,165kg) was E. deani, the rest was E. stoutii. The estimate of catch per trap using “Korean traps” was 1.4 kg.

In 1989, three vessels landed 156 tonnes of hagfish at Newport and Astoria, with a decreased CPUE catch of about 0.8 kg of hagfish per trap. In 1990, the catch dropped with 11 vessels landing 75 tonnes of hagfish from 102 trips (0.73 tonnes/trip) but since then there has been an increase in total hagfish landings and CPUE but the catch has mostly been comprised of E. stoutii. In 1991, 12 vessels landed 124 metric tonnes from 131 trips (0.94 tonnes/trip), and in 1992, 15 vessels landed 340 metric tonnes of hagfish from 310 trips (1.09 tonnes/trip) (Barss 1993). Mixed catch reported from the US to the FAO, also shows a variable but increasing trend in landings from a low of 100 tonnes in 2000 to a peak of 600 tonnes in 2005 (FishSTAT 2009).

Catch data from British Columbia is very low, but suggests that there has been a decline in effort along with decline in metric tonnes landed. However it is not known how much of this decline was due to the poor quality of skins that were produced, or a decline in abundance of the hagfish, or to competition from the east coast fisheries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation measures in place, but regulations are in the process of being implemented to manage fishing effort.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no negative impacts of Pacific hagfish on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

In Korea, approximately 5 million pounds of Pacific hagfish meat is consumed yearly, and in many countries the skin is commonly processed into "eelskin" accessories such as purses, wallets, and boots. Hagfish are sometimes found in public aquariums, and their very low metabolic rate is of specific research interest.

Positive Impacts: food ; body parts are source of valuable material; research and education

  • Barnaby, R., G. Nardi, K. Cho, J. Goldman. 1995. "Trade Barriers Lifted on Hagfish Exports to Korea Earnings of Developing New England Fishery Expected to Double" (On-line). Sea Grant News Media Center. Accessed October 15, 2005 at http://www.seagrantnews.org/news/hagfish.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pacific hagfish

The Pacific hagfish (Eptatretus stoutii) is a species of hagfish. It lives in the mesopelagic to abyssal Pacific ocean, near the ocean floor. It is a jawless fish, a throwback to the Paleozoic Era when fish evolved. Deep-sea diving equipment is known to have been fouled by large amounts of hagfish slime near the bottom of the ocean, extruded by the eel-like fish when they are alarmed.

The hagfish is notorious for its slimy skin. When disturbed, it oozes proteins from slime glands in its skin that respond to water by becoming a slimy outer coating, expanding it into a huge mass of slime. This makes them very unsavory to predators. Hagfish create large amounts of slime in just minutes. One scientist researching this protein excretion concluded that a single hagfish could fill an entire barrel with slime in less than 100 minutes.[1]

In many parts of the world, including the US, hagfish-skin clothing, belts, or other accessories are advertised and sold as "yuppie leather" or "eel-skin"[2] (hagfish are not true eels, which are bony fish with jaws).

The hagfish is eaten in Korea and other Asian countries, along with its eggs and its slime. The section of the fishing industry devoted to hagfish-fishing has grown in recent years.

The hagfish has feelers that enable it to find food more easily. It is an opportunistic feeder, and eats dead and rotting animals that float down from the pelagic zone of the ocean. Swarms of hagfish will descend upon and penetrate the carcass and devour it from the inside out. This mode of marine waste disposal allows the hagfish to efficiently gain nutrients. The resultant rarity of rotting animals on the sea floor is one of the factors that modulates global cycles of phosphorus, carbon and nitrogen.

This fish is often referred to as the "slime eel". This is an incorrect common name / nickname.

Eating habits[edit]

The pacific hagfish has a property of being able to absorb nutrients through its skin; it is unique among all 50,000 vertebrates, and it is believed that is the closest animal we can get to the first vertebrate. The fish burrows into dead carcasses, exposing its skin to super nutrient-rich decomposing matter, and eating away at the dead animal. Chris Glovet, at the University of Canterbury in Christchurch, New Zealand, tested his theory by putting skin samples of the hagfish in between nutrient rich seawater and a solution similar to the hagfish's body fluids. They found out that in fact amino acids flowed right through.[3][4]

Pacific hagfish at 150 metres' depth, Cordell Bank National Marine Sanctuary, California.

Fertilisation[edit]

Hagfish have both male and female specimen and they fertilise their eggs externally meaning they fertilise after the female lays her eggs. On average females lay about 28 eggs over five millimetres in diameter and they carry them around where ever they swim. However, females try to stay in the dens that they burrowed to ensure the protection of their eggs and the protection of themselves.[5]

Hagfish slime[edit]

The Pacific hagfish produces prodigious quantities of slime and particularly, it seems, when responding specifically to situations where it serves as protection, or more generally to stress. The Pacific hagfish creates its thick, gooey slime by opening a valve that scientists believe pushes water into its olfactory organ. The slime is notoriously difficult to remove from fishing gear and equipment. Because of the slime they make, Pacific fisherman, who collect hagfish to sell in Asian markets to use as leather or food, have nicknamed the creature the slime eel.[6]

References[edit]

  1. ^ Muse magazine, 2006
  2. ^ Barss, William (1993), "Pacific hagfish, Eptatretus stouti, and black hagfish, E. deani: the Oregon Fishery and Port sampling observations, 1988-92", Marine Fisheries Review (Fall, 1993), retrieved April 21, 2010 
  3. ^ Bucking, Carol. "Digestion under Duress: Nutrient Acquisition and Metabolism during Hypoxia in the Pacific Hagfish.". Retrieved 6 December 2011. 
  4. ^ Barras, Colin. "The hag with impeccable table manners". Retrieved 6 December 2011. 
  5. ^ Barbs, William. "Pacific hagfish, Eptatretus stouti, and black hagfish, E. deani: The Oregon fishery and port...". National Marine Fisheries Service. Retrieved 6 December 2011. 
  6. ^ Theisen, Birgit. "The Olfactory System in the Pacific Hagfishes Eptatretus stoutii, Eptatretus deani, and Myxine circifrons.". Blackwell publishing. Retrieved 6 December 2011. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!