Overview

Comprehensive Description

Biology

A benthic and solitary species (Ref. 26340) found commonly on reefs and rocky shore areas. Feeds on small fishes and crustaceans (Ref. 5521). At Fernando de Noronha Archipelago, offNE Brazil, forages for sally lightfoot crabs (Grapsus grapsus) on exposed reefs at ebb tide and in tide-pools mostly at daytime. Able to withstand up to 30 minutes out of water while foraging, uses four main tactics both in and out of the water. Searches for prey at pool rims and rock bases poking into crevices and holes, stealthily approaches previously sighted prey, chases prey and ambushes prey from under rocks and crevices. Hunting success varies with employed tactic, but overall success is about 50%. May move up to 6 meters in about 1 hour while foraging on the exposed reef. Its crab hunting is mostly visually guided and a fish darting nearby a stealthily foraging moray may cause it to miss the strike; the missed crab may be chased up to 5 m on the reef. Able to strike with its body partly or entirely out ofthe water, usually strikes from a distance of 5 to10 centimeters. Small crabs are swallowed whole, whereas larger ones are torn apart by a combination of tugging, rotating, knotting, and thrashing movements. Handling time is related to prey size, the largest crabs (carapace width 2.3-3.2 times larger than moray’s head width) broken up and swallowed within 90 to 240 seconds. Attracted to plastic or rubber decoys dragged on a nylon string nearby, striking at these (Ref. 50922).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: Bermuda, Florida (USA), and the Bahamas to the Antilles (Ref. 26340) and Brazil. Eastern Atlantic: Cape Verde (Ref. 34514) and Ascension Island (Ref. 4450). The only record from West Africa is probably erroneous (Ref. 4450). Also southern Atlantic islands (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 1650 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

165 cm TL (male/unsexed; (Ref. 26340))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

With short blunt snout, yellow chain-like markings, teeth bluntly pointed or molar-like especially on roof of mouth (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 0 - 12 m (Ref. 9710), usually 0 - 2 m (Ref. 40849)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 36 specimens in 1 taxon.
Water temperature and chemistry ranges based on 24 samples.

Environmental ranges
  Depth range (m): 0.3 - 10
  Temperature range (°C): 27.075 - 29.336
  Nitrate (umol/L): 0.161 - 1.225
  Salinity (PPS): 34.217 - 36.024
  Oxygen (ml/l): 4.454 - 4.662
  Phosphate (umol/l): 0.006 - 0.344
  Silicate (umol/l): 1.338 - 4.423

Graphical representation

Depth range (m): 0.3 - 10

Temperature range (°C): 27.075 - 29.336

Nitrate (umol/L): 0.161 - 1.225

Salinity (PPS): 34.217 - 36.024

Oxygen (ml/l): 4.454 - 4.662

Phosphate (umol/l): 0.006 - 0.344

Silicate (umol/l): 1.338 - 4.423
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 12m.
Recorded at 12 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

A benthic species (Ref. 26340) found commonly on reefs and rocky shore areas . Feeds on small fishes and crustaceans (Ref. 5521). Carnivore (Ref. 57616). At Fernando de Noronha Archipelago, off NE Brazil, forages for sally lightfoot crabs (Grapsus grapsus) on exposed reefs at ebb tide and in tide-pools mostly at daytime. Able to withstand up to 30 minutes out of water while foraging, uses four main tactics both in and out of the water. Searches for prey at pool rims and rock bases poking into crevices and holes, stealthily approaches previously sighted prey, chases prey and ambushes prey from under rocks and crevices. Hunting success varies with employed tactic, but overall success is about 50%. May move up to 6 meters in about 1 hour while foraging on the exposed reef. Its crab hunting is mostly visually guided and a fish darting nearby a stealthily foraging moray may cause it to miss the strike; the missed crab may be chased up to 5 m on the reef. Able to strike with its body partly or entirely out ofthe water, usually strikes from a distance of 5 to10 centimeters. Small crabs are swallowed whole, whereas larger ones are torn apart by a combination of tugging, rotating, knotting, and thrashing movements. Handling time is related to prey size, the largest crabs (carapace width 2.3-3.2 times larger than moray’s head width) broken up and swallowed within 90 to 240 seconds. Attracted to plastic or rubber decoys dragged on a nylon string nearby, striking at these (Ref. 50922).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Echidna catenata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Echidna catenata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATTTAGTATTTGGTGCTTGGGCCGGGATAGTCGGCACTGCGCTAAGCCTCCTTATCCGGGCCGAACTTAGCCAGCCTGGAGCCCTTTTAGGAGACGATCAAATCTACAACGTTATCGTTACAGCTCATGCCTTCGTAATAATCTTCTTTATAGTAATACCTGTAATGATTGGAGGCTTCGGAAACTGGCTTGTACCACTGATAATCGGAGCCCCCGACATAGCTTTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCACCATCATTTCTTCTCCTATTGGCCTCCTCAGGCGTAGAGGCAGGGGCTGGAACTGGCTGAACTGTCTACCCCCCTCTCGCAGGAAACCTAGCCCACGCCGGCGCATCCGTCGATTTAACTATTTTCTCTCTCCACTTGGCCGGGGTATCATCAATCCTAGGGGCAATTAACTTTATTACAACTATTATTAACATGAAGCCCCCAGCTATTACACAATACCAAACACCTCTATTTGTATGAGCAGTACTAGTTACAGCCGTACTTCTACTACTCTCTCTCCCAGTACTAGCCGCCGGGATTACAATGCTTTTAACTGACCGAAACCTTAACACAACATTCTTTGACCCTGCTGGAGGAGGAGACCCAATTCTTTATCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Echidna catenata

Echidna catenata, commonly known as the chain moray, is a moray eel found in shallow parts of the western Atlantic Ocean and from islands elsewhere in the Atlantic. It occasionally makes its way into the aquarium trade. It grows to a maximum length of 165 cm (65 in) but a more common length is about 40 cm (16 in).[2]

Description[edit]

The chain moray is an elongated, heavy, eel-like fish that commonly grows to a length of about 30 to 45 cm (12 to 18 in). The head has a rounded snout and pointed, blunt teeth, especially on the roof of the mouth. The dorsal, tail and anal fins are combined into a single long fin, and there are no pectoral or ventral fins. The skin does not bear scales but is covered with a layer of clear mucus. This fish is dark brown to black, marked with an interconnecting lattice-work of yellow, chain-like lines. The eyes are yellow.[2][3]

Distribution and habitat[edit]

The chain moray is found in the western Atlantic Ocean where its range extends from Bermuda, Florida and the Bahamas to the Antilles and Brazil. It is common in the Caribbean, and is also reported from the eastern Atlantic (Cape Verde and Ascension Island) and some southern Atlantic islands. It is found on reefs and rocky shores in clear water at depths of less than 12 m (39 ft), and usually within 2 metres (6 ft) of the surface.[2]

Biology[edit]

The chain moray is mainly nocturnal, hiding in holes and crevices in shallow water during the day, often with its head projecting. It is continually opening and closing its mouth in order to increase the flow of water over its gills.[3] It is a carnivore and feeds on such organisms as crabs, which are the mainstay of its diet, shrimps, worms and small fish. Its blunt teeth are especially adapted for feeding on crustaceans. It does not always leave its hiding place to forage, sometimes remaining where it is, ready to grab any prey that passes.[4] It sometimes forages in tide pools and is able to survive for up to half an hour out of water.[2] As well as ambushing prey, its feeding strategies include searching under the rims of pools, beneath rocks and in holes for prey, stalking observed prey or chasing it for a distance of up to 5 m (16 ft). When close enough to its prey, usually when it is within 5 to 10 cm (2 to 4 in), it strikes, an action it can perform with its body wholly or partly out of the water. When captured, large crabs are torn apart while small ones are swallowed whole.[2]

References[edit]

  1. ^ a b Bailly, Nicolas (2013). "Echidna catenata (Bloch, 1795)". World Register of Marine Species. Retrieved 2014-05-11. 
  2. ^ a b c d e Froese, Rainer. "Echidna catenata (Bloch, 1795)". FishBase. Retrieved 2014-05-10. 
  3. ^ a b De Kluijver, M.; Gijswijt, G.; de Leon, R.; da Cunda, I. "Chain moray (Echidna catenata)". Interactive Guide to Caribbean Diving. Marine Species Information Portal. Retrieved 2014-05-09. 
  4. ^ Randell, J. E. (1967). "Chain moray". Food habits of reef fishes of the West Indies. Retrieved 2014-05-09. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!