Overview

Comprehensive Description

Biology

Inhabits sandy areas, often around rocks and kelp beds (Ref. 2850). Benthic (Ref. 58302). Feeds on crabs and mollusks (Ref. 4925). Ovoviviparous (Ref. 50449).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: stingray (English), raya-látigo (Espanol)
 
Dasyatis dipterura (Jordan & Gilbert, 1880)


Diamond stingray,     Shortail stingray,     Whiptail stingray


Disc oval to roughly diamond-shaped, broader than long; front-side margins of disc nearly straight; snout pointed, very slightly projecting; tail slightly longer than length of disc; tail fin absent, but fin folds on upper and lower surface of tail, upper fold short and low, lower fold longer and deeper, both folds end abruptly at the same place on the taill; upper surface of disc mainly smooth except for a long central row of thorns on back and base of tail, that is flanked on each side by short row of thorns or spines on middle of disc.

Generally dark brown or blackish without distinctive markings.

Maximum length, 180 cm (disc width 122 cm).

Inhabits sand-mud bottoms.

Depth: 0-70 m.

Southern California to Peru, the Revillagigedos, the Galapagos.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Eastern Pacific: southern California, USA to Peru. Reported from the Galapagos Islands (Ref. 5530). Occurrence in British Columbia, Canada remains questionable (Ref. 6885). Not in Compagno's 1999 checklist (Ref. 35766).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Reports of this stingray from British Columbia, Canada (Hart 1973) are questionable and have not been verified. If accurate, they represent anomalies, as D. dipterura is typically a subtropical to tropical species. The confirmed range is from southern California, USA to Chile (where it is occasional only); including the Galápagos and Hawaiian Islands (Eschmeyer et al. 1983, Nishida and Nakaya 1990, Lamilla et al. 1995).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hawaiian Islands; Eastern Pacific: Galapagos Archipelago and California (U. S. A.) to Peru.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 70 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, East Pacific endemic, Tropical Eastern Pacific (TEP) endemic

Regional Endemism: All species, TEP endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 180.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1220 mm WD
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

122 cm WD (male/unsexed; (Ref. 2850))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Syntype for Dasyatis dipterura
Catalog Number: USNM 110967
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Dry Osteological Specimen
Collector(s): D. Jordan
Year Collected: 1880
Locality: San Diego, California, San Diego County, California, United States, Pacific
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Syntype for Dasyatis dipterura
Catalog Number: USNM 26782
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Unknown
Collector(s): D. Jordan
Year Collected: 1880
Locality: San Diego, California, San Diego County, California, United States, Pacific
  • Syntype: Jordan, D. S. & Gilbert, C. H. 1881 (1880). Proceedings of the United States National Museum. 3 (106): 31.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Dasyatis dipterura
Catalog Number: USNM 24880
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan & C. Gilbert
Year Collected: 1880
Locality: San Diego, San Diego County, California, United States, North America, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; marine; depth range 10 - 355 m (Ref. 58302)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Dasyatis dipterura is a demersal stingray known primarily from relatively shallow, inshore waters over sand and mud bottoms or near rocky outcrops and kelp beds (Feder et al. 1974, Eschmeyer et al. 1983). Off southern California, the species has been reported to occupy shallow waters (intertidal to 7 m) in the summer and moves to depths of 13 to 17.7 m during the late fall and winter months (Feder et al. 1974). In Chile the species has been reported at depths of 3 to 30 m. However, Chave and Mundy (1994) reported D. dipterura from depths of 52 to 150 m over sand bottoms in the Hawaiian archipelago. The Hawaiian records may represent a misidentification or indicate that a much broader depth range may be potentially utilized by this species.

The limited biological information available for D. dipterura is derived primarily from the Bahía Magdalena lagoon complex, Baja California Sur, México. These parameters may differ markedly throughout the species? range. In the Bahía Magdalena lagoon complex, courtship and insemination is thought to occur in the late summer during July and August (Mariano-Melendez 1997). Sperm storage or diapause may contribute to delayed development of embryos and gestation is suggested to occur over 2 to 2.5 months with pupping taking place the following summer (July-September) in shallow estuaries (Mariano-Melendez 1997). Reproduction appears to be annual and litter sizes range from one to four pups (Mariano-Melendez 1997, Smith 2004). Reproductive mode is aplacental viviparity in which embryos are nourished by a combination of a small yolk-sac and histotrophe secreted from the uterus (as with all myliobatoid rays). Only a single ovary is functional. Maximum size is ~100 cm disc width (DW) (McEachran and Notarbartolo-di-Sciara 1995) and size at birth ranges 18 to 23 cm DW (Mariano-Melendez 1997, Smith 2004). The median size at maturity is estimated to be 58.5 cm DW (males) and 43.4 cm DW (females). Growth estimates based on vertebral ageing indicate that these sizes correspond to ages of 10 years in females and seven years in males (see life history parameters below for other maturity estimates). Age analysis indicates slow growth rates and maximum observed ages up to 28 years. Von Bertalanffy models estimate growth coefficients of 0.55 y-1 for females and 0.10 y-1 for males (Smith 2004). Females attain greater sizes and ages than males. Catch records suggest that the species may segregate by size and sex (Mathews and Druck-Gonzalez 1975, Smith 2004).

Diet is comprised primarily of infaunal organisms and large feeding pits are excavated by jetting water and through movements of the pectoral fins. Some epibenthic species are also taken. In the Bahía Magdalena lagoon complex, pea crabs (Pinnotheridae), razor clams (Solyema valvulus) and polychaetes are the primary prey items, in order of decreasing importance (Bizzarro 2005).

Life history parameters
Age at maturity: 10 years (50% maturity) (Smith 2004) (female); 7 years (50% maturity) (Smith 2004) (male).
Size at maturity (disc width): 50% Maturity: 58.5 cm DW (Smith 2004), 65.5 cm DW (Mariano-Melendez 1997), 1st Maturity: 57 cm DW (Smith 2004) (female); 50% Maturity: 43.3 cm DW (Smith 2004), 45.5 cm DW (Mariano-Melendez 1997), 1st Maturity: 47 cm DW (Smith 2004) (male).
Longevity: at least 28 years (maximum observed) (Smith 2004).
Maximum size (disc width): ~100 cm DW (McEachran and Notarbartolo-di-Sciara 1995).
Size at birth: 18 to 23 cm DW (Mariano-Melendez 1997, Smith 2004).
Average reproductive age: 14.6 years (Smith 2004).
Gestation time: ~2.5 to 3 months (Mariano-Melendez 1997).
Reproductive periodicity: Annual (Mariano-Melendez 1997).
Average annual fecundity or litter size: Maximum observed: 4 (Mariano-Melendez 1997); Mean litter size: 2.7 (Smith 2004).
Annual rate of population increase: Mean ? = 1.06 per year (Smith 2004).
Natural mortality: General indirect estimates: 0.07 to 0.15 per year (range; multiple methods of estimation) (Smith 2004); Age-specific indirect estimates: 0.03?0.35 per year (range; Peterson and Wroblewski and Chen and Watanabe approaches) (Smith 2004).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 17m.
Recorded at 17 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Brackish

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef associated (reef + edges-water column & soft bottom), Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Soft bottom only, Mud, Sand & gravel

FishBase Habitat: Demersal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits sandy areas, often around rocks and kelp beds (Ref. 2850). Benthic (Ref. 58302). Feeds on crabs and mollusks (Ref. 4925). Mobile-invertebrate feeder (Ref. 57615).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), mobile benthic gastropods/bivalves
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Exhibit ovoviparity (aplacental viviparity), with embryos feeding initially on yolk, then receiving additional nourishment from the mother by indirect absorption of uterine fluid enriched with mucus, fat or protein through specialised structures (Ref. 50449). Distinct pairing with embrace (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 28 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Egg Type: Live birth, No pelagic larva, No pelagic phase
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dasyatis dipterura

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTCTTTGGTGCATGAGCGGGGATAGTGGGCACTGGTCTCAGTCTGTTAATCCGAACAGAATTAAGTCAACCCGGCGCATTACTAGGGGATGACCAAATCTACAATGTAATCGTTACCGCCCACGCTTTCGTGATAATTTTCTTCATAGTTATGCCAATTATGATCGGGGGATTTGGTAACTGACTGGTTCCCTTAATAATCGGTGCTCCAGATATAGCCTTTCCACGAATAAATAACATAAGTTTTTGACTTCTTCCCCCATCCTTCCTTTTACTACTCGCCTCAGCAGGAGTAGAAGCCGGAGCTGGCACAGGATGAACAGTCTATCCTCCACTGGCCGGCAATCTTGCACATGCTGGGGCTTCCGTAGACCTTACTATCTTCTCTCTCCACTTAGCTGGAGTCTCCTCTATTCTAGCGTCTATTAACTTTATCACAACAATCATTAATATGAAACCACCTGCAATCTCCCAATACCAAACACCTCTCTTTGTTTGATCCATCCTCATTACAACAGTCCTCCTTTTACTATCACTCCCAGTTCTAGCAGCAGGTATTACCATACTTCTTACAGACCGTAATCTTAACACAACTTTCTTCGACCCAGCAGGCGGAGGAGACCC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dasyatis dipterura

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2006

Assessor/s
Smith, W.D., Bizzarro, J.J. & Lamilla, J.

Reviewer/s
Kyne, P.M. & Fowler, S.L. (Shark Red List Authority)

Justification
Dasyatis dipterura is a broadly distributed but poorly known stingray from the eastern Pacific. Biological and fishery information is primarily available from México where D. dipterura is commonly landed among artisanal elasmobranch fisheries and frequently taken as bycatch in trawl fisheries (especially by shrimp trawlers). Populations from the Mexican Pacific display seasonal movement patterns related to reproductive events, but no information is available on trends in abundance. Recent studies indicate that this stingray is relatively long lived (to at least 28 years), has a low fecundity (1 to 4), and a low intrinsic rate of increase. Female growth rates are estimated to be among the lowest reported for any batoid. These combined factors indicate that D. dipterura populations are of low productivity and demonstrate limited resilience to fishing pressure. Due to its vulnerability and importance within the unregulated artisanal elasmobranch fishery, this stingray is considered Near Threatened in México. Based on the lack of information pertaining to the biology, distribution, and fisheries for this species throughout the majority of its range, D. dipterura is classified as Data Deficient in the USA as well as Central and South America. Where is it taken in fisheries in those regions it may prove to be at risk when more information is available.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Listed, Data deficient

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Rough estimates of D. dipterura abundance were calculated by Mathews and Druck-Gonzalez (1975) from the Bahía Magdalena lagoon complex, Baja California Sur, México based on trawl surveys. These authors noted a distinct seasonal trend in abundance within the lagoon complex and estimated 112,000 individuals present in February, increasing to 378,000 in August. Species identifications were problematic and these estimates may include D. longa or urotrygonid rays. In the Gulf of California, exploratory trawl surveys indicated that D. dipterura comprised 26% of the total demersal catch weight (Flores et al. 1995). No details on the abundance of this species outside of México are available.

In Chile, the southern extent of the species? distribution, and southern California, the northern extent of its distribution, this species is rare. In Chile, it is known only from three specimens taken in the north (Antofagasta). Its occurrence in these extremities of its range appears to be linked to suitable climatic conditions due to El Niño (Lamilla, et al. 1995, Ebert, 2003).

No information on subpopulations or fragmentation is available.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Directed artisanal fisheries and incidental catch among trawl fisheries and other artisanal fisheries using gillnets, longlines, or traps.

Dasyatis dipterura represents a primary component of artisanal elasmobranch fishery catches of the Pacific coast of México and the Gulf of California (Bizzarro et al. 2000, R. Hueter et al. unpublished data, Smith 2004, Bizzarro 2005). Its contribution to the fishery is likely underestimated due to the lack of species-specific landing information and potential misidentification. Although present in artisanal landings throughout the year, catches of this stingray are highest during the summer and fall (Notarbartolo di Sciara 1987; Bizzarro et al. 2000). Dasyatis dipterura is the second most abundant batoid landed in coastal waters of Sonora, México, comprising ~19% of all batoid landings in seasonal surveys conducted in 1998 and 1999 (R. Hueter et al., unpublished data, Márquez-Farías 2002). This species is targeted during primarily summer months in Bahía Almejas, located in the southern portion of the Bahía Magdalena lagoon complex, Baja California Sur, México. In this embayment, it is most abundant batoid species landed in August (~43%) and the fourth most abundant batoid in June landings (~8%) (Bizzarro 2005). Individuals are primarily captured in demersal gillnets in which their tail spines are entangled. This method of entanglement allows a wide range of mesh sizes to be effective for capturing juveniles as well as adults. Juveniles comprised the majority of individuals landed in the Bahía Magdalena lagoon complex artisanal elasmobranch fishery during 1998?2000 (Smith 2004, Bizzarro 2005, Bizzarro and Smith in preparation).

Based on records from exploratory fishing surveys, it is likely that this species represents a significant component of trawl bycatch fisheries (especially shrimp trawl bycatch) in the Mexican Pacific (Mathews and Druck-Gonzalez 1975, Flores et al. 1995). No information is available on the species? actual contribution to bycatch in other artisanal or trawl fisheries in México, or through its Central and South American range.

Many coastal embayments and mangrove lagoons in north Pacific México, which serve as habitat for D. dipterura, are being altered for the purpose of shrimp farming. Although these activities are presently limited, their expected increase could detrimentally alter suitable habitat for this species (Bizzarro pers. obs.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Dasyatis dipterura fisheries and bycatch are unmanaged throughout the species range. In México, a moratorium on the issue of elasmobranch fishing permits was enacted in 1993, but no formal management plan has been implemented. However, legislation is currently being developed in México to establish national elasmobranch fishery management. Elasmobranch fisheries are unmanaged throughout Central and South America. Attempts to monitor and regulate fisheries in the eastern tropical Pacific would greatly improve conservation of D. dipterura and other chondrichthyans.

Elasmobranch landings reported from México and Central America typically lack species-specific details. Large sharks are generally grouped as ?tibur?nes? and small sharks as ?cazonés? while batoids are often simply termed ?manta raya? collectively. Mexican federal fisheries agencies recently began providing slightly more taxonomic resolution of ray landings by listing several new categories. Landings of D. dipterura, however, may still be unknown as they are grouped in the modified category of ?manta raya? that may include dasyatid as well as urotrygonid and mobulid species. Additional monitoring of artisanal elasmobranch fisheries and commercial trawl bycatch on a species-specific basis is critical for detecting trends in effort, abundance, and catch of elasmobranchs. Concise guides to species identification for both fishermen and fisheries biologists would be a valuable aid for improving the monitoring of these landings. Fishery-independent surveys of this and other demersal elasmobranchs are necessary to provide estimates of abundance and biomass.

In addition to species-specific catch details, life history information including age, growth, longevity, movement patterns, habitat use, diet, and further reproductive studies from other portions of the species range are necessary to develop effective conservation actions for D. dipterura. Direct estimates of fishing and natural mortality are critical for assessing the impact of fisheries on a species and would greatly improve population models of this vulnerable species.

The development and implementation of management plans (national and/or regional e.g., under the FAO International Plan of Action for the Conservation and Management of Sharks: IPOA?Sharks) are required to facilitate the conservation and sustainable management of all chondrichthyan species in the region. See Anon. (2004) for an update of progress made by nations in the range of D. dipterura.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Diamond stingray

The diamond stingray (Dasyatis dipterura) is a species of stingray in the family Dasyatidae. It is found in the coastal waters of the eastern Pacific Ocean from southern California to northern Chile, and around the Galápagos and Hawaiian Islands. This bottom-dweller generally inhabits sandy or muddy flats near rocky reefs and kelp forests, to a depth of 30 m (98 ft), though off Hawaii it may range considerably deeper. As its common name suggests, this species has an angular, diamond-shaped pectoral fin disc that is plain brown or gray above, with rows of tubercles along the midline and on the "shoulders". The long, whip-like tail has both dorsal and ventral fin folds, which distinguish this ray from the closely similar longtail stingray (D. longa). It typically grows to 1 m (3.3 ft) across.

When searching for food, diamond stingrays may form groups of up to hundreds of individuals. It is most active at night and preys mainly on burrowing invertebrates and small bony fishes, which are extracted from the bottom via suction or digging. This species is aplacental viviparous: once the embryos exhaust their yolk supply, they are nourished by histotroph ("uterine milk") produced by the mother. Females bear 1–4 pups every summer in estuaries; mating is followed by a ten-month period of either sperm storage or arrested embryonic development, after which the embryos rapidly mature over 2–3 months. The slowest-growing stingray known, this species is not resilient against fishing pressure. It is caught for food by artisanal fishers in Latin America, particularly in Mexico where it is one of the most economically important rays. This has led it to be assessed as Near Threatened in Mexico by the International Union for Conservation of Nature (IUCN), while the species as a whole is listed as Data Deficient. Though innocuous towards humans, the diamond stingray's long, venomous tail spine is potentially dangerous.

Contents

Taxonomy and phylogeny

In 1880, the diamond stingray was described twice by three American ichthyologists: as Dasybatus dipterurus by David Starr Jordan and Charles Henry Gilbert in Proceedings of the United States National Museum, and as Trygon brevis by Samuel Garman in Bulletin of the Museum of Comparative Zoology.[2][3] Jordan and Gilbert's account was published in May while Garman's was published in October, making dipterurus (feminine dipterura) the correct name as it was published first. However, when Garman synonymized the two in 1913 he inappropriately gave precedence to brevis, leading to long-standing confusion.[4] Both Dasybatus and Trygon were later synonymized with the genus Dasyatis, but many authors still listed D. brevis in place of or in addition to D. dipterura.[5][6] Garman also synonymized the Hawaiian stingray (D. hawaiensis) with D. dipterura in 1913, which has since been followed by most authors but requires more study for confirmation.[7]

The species syntypes were collected from San Diego Bay, California.[5] The specific epithet dipterura is derived from the Latin di ("two"), ptero ("wing"), and ura ("tail"), referring to the fin folds on both sides of its tail. Rat-tailed stingray is a former common name for this species.[6] Lisa Rosenberger's 2001 phylogenetic analysis, based on morphology, determined the diamond stingray and the bluntnose stingray (D. say) of the western Atlantic Ocean to be sister species, that likely diverged before or with the formation of the Isthmus of Panama (c. 3 Ma). In addition, the two were found to be the second-most basal taxa in their genus, after the common stingray (D. pastinaca).[8]

Distribution and habitat

A ray in shallow water off a beach
During the summer, the diamond stingray is common in the shallows off beaches.

The diamond stingray is found in the eastern Pacific Ocean from southern California to northern Chile, as well as around the Galápagos and Hawaiian Islands; it is very abundant around Baja California and in the Gulf of California. At the northern and southern extremes of its range, it is generally only present during periods of suitably warm water brought about by El Niño.[6] There is a record of this ray from off British Columbia, which is unconfirmed and would be highly anomalous as it is known to be a tropical and warm-temperate species.[1]

A bottom-dwelling inhabitant of inshore waters, the diamond stingray favors sandy or muddy bottoms, often near rocky reefs or kelp forests. Off southern California, it usually occurs from the intertidal zone to a depth of 7 m (23 ft) during the summer, shifting to depths of 13–18 m (43–59 ft) during late fall and winter.[1] For unknown reasons, it prefers to overwinter in kelp forests rather than sandy flats.[6] Off Chile, the diamond stingray occurs at a similar depth of 3–30 m (10–100 ft). On the other hand, this species has been reported from as far down as 355 m (1,165 ft) off Hawaii, which if accurate would suggest that it utilizes a much greater range of depths than previously realized.[1][9]

Description

A ray lying on the bottom, partially buried in sand, next to a reef outcrop
A distinguishing trait of the diamond stingray is the presence of fin folds both above and below the tail.

The diamond stingray attains a disc width of 1 m (3.3 ft) or possibly 1.2 m (3.9 ft); females grow larger than males.[1][10] Its pectoral fin disc is rhomboid in shape, slightly wider than long, with angular outer corners and subtly convex margins. The snout is blunt-angled and non-projecting. The eyes are fairly large and immediately followed by the spiracles (paired respiratory openings). The mouth is strongly curved, containing 21–37 upper tooth rows and 23–44 lower tooth rows; the teeth are small and blunt, and arranged into flattened surfaces. Three or five papillae (nipple-like structures) are found in a row across the floor of the mouth.[6][7][11]

The whip-like tail generally measures up to one and half times the length of the disc, and bears one (more if replacements have grown in) long, slender, serrated spine on the upper surface, closer to the base than the tip.[6][10][12] Behind the spine, there are long dorsal and ventral fin folds that rise gradually, reaching a relatively high apex before sloping down abruptly.[7] The presence of the upper fin fold separates this species from the similar longtail stingray (D. longa), which shares most of its range. However, the tail is often damaged, in which case differentiating the two species in the field becomes all but impossible.[13] Young rays have completely smooth skin, while adults develop a row of low tubercles along the midline of the back, flanked by two shorter rows on the "shoulders". The tail also becomes covered in prickles.[11] This species is a uniform olive to brown to gray above, darkening to black on the tail, and off-white below.[6][13]

Biology and ecology

A brown ray swimming just above a fine gravel bottom
The diamond stingray may be found alone, but more often forms groups of varying size.

The diamond stingray is most active at night, spending much of the day buried in sand with only its eyes protruding. When foraging for food, it may be solitary but more commonly forms groups numbering up to the hundreds. There is strong segregation by sex and age. This species feeds on crustaceans, molluscs, and other invertebrates, as well as small bony fishes; its powerful jaws and molar-like teeth allow it to crush hard-shelled prey.[6][13] It mainly targets burrowing organisms, but may also take prey exposed on the bottom.[1] There is a record of a female 69 cm (27 in) across, that had gorged herself on at least 30 small crabs.[13] In the Bahía Magdalena lagoon complex, Baja California Sur, its most important source of food are pea crabs, followed by the razor clam Solyema valvulus, and then polychaete worms.[1]

The typical hunting strategy of the diamond stingray is to cruise just above the sea floor, landing atop any prey encountered. It then quickly levers its body up-and-down with its disc, producing negative pressure to extract the prey from its burrow.[6] This ray has also been known to excavate large pits by undulating its disc and spitting jets of water, so as to uncover buried prey.[1] Diamond stingrays are frequently trailed by smaller fishes, including Mexican hogfish (Bodianus diplotaenia), Galapagos porgies (Calamus taurinus), greybar grunts (Haemulon sexfasciatum), spinster wrasses (Halichoeres nichols), and long-spine porcupinefish (Diodon holocanthus), which take advantage of the invertebrates stirred up by the ray's activities.[14] Known parasites of this species include the tapeworms Acanthobothrium bullardi, A. dasi, A. rajivi, and A. soberoni,[15] Anthocephalum currani,[16] Parachristianella tiygonis,[17] and Pseudochristianello elegantissima,[18] the flukes Anaporrhutum euzeti and Probolitrema mexicana,[19][20] and the monogenean Listrocephalos kearni.[21]

Like other stingrays, the diamond stingray is aplacental viviparous: the embryos are initially nourished by yolk, and later by histotroph ("uterine milk", rich in proteins and lipids) produced by the mother.[1] Only the left ovary and uterus are functional in adult females.[22] Several bays along the Pacific coast of Baja California are known to serve as nurseries.[6] Most of the life history information available on this species has come from Bahía Magdalena, where females bear one litter of 1–4 pups per year. Courtship and mating occurs in late summer from July to August, but due to a ten-month period of either sperm storage or diapause (wherein the embryo becomes dormant), embryonic development does not begin until the following year and is completed within 2–3 months. Birthing takes place in summer from July to September in shallow estuaries; the newborns measure 18–23 cm (7.1–9.1 in) across.[1][22] During El Niño years, the higher temperatures appear to shift the timing of birth forward.[6] The diamond stingray has the lowest growth rate of any stingray species yet studied. Males reach sexual maturity at around 43–47 cm (17–19 in) across and 7 years of age, while females grow slower still, reaching maturity at around 57–66 cm (22–26 in) across and 10 years of age.[1][22] The maximum lifespan has been estimated at least 19 years for males and 28 years for females.[22]

Human interactions

At least one fatality off southern California has resulted from the long, venomous tail spine of the diamond stingray. However, it is not aggressive and will usually flee given the opportunity. This ray is not found off the United States in sufficient numbers to be economically important. Elsewhere in its range, it is caught in substantial numbers for human consumption, both intentionally and as bycatch; the pectoral fins or "wings" are sold fresh or filleted and salted.[6] The International Union for Conservation of Nature (IUCN) notes that the diamond stingray's low reproductive productivity renders it susceptible to population depletion, but currently lacks enough biological and fishery data to assess it beyond Data Deficient overall, or in the U.S., Central, and South American parts of its range.[1]

In Mexico, the diamond stingray is one of the most important components of Pacific artisanal shark and ray fisheries, comprising around a tenth of the total annual catch.[6] Its significance is likely underestimated, as Mexican fishery reports frequently suffer from misidentifications and a lack of species-specific data. It is mainly caught during summer and fall, being the most common ray landed in Bahía Magdalena, and second most common ray landed off Sonora state. Demersal gillnets are the main fishing gear employed; both adult and juvenile rays easily become entangled in the mesh by their tail spines, with juveniles known to have comprised most of the Bahía Magdalena catch in 1998–2000. This species is also often caught incidentally in bottom trawls, on longlines, and in fish traps. In the future, habitat degradation from increasing numbers of shrimp farms may pose an additional threat to this species in the region. As a result of these pressures, the IUCN has assessed the diamond stingray as Near Threatened in Mexican waters. No management schemes have yet been enacted for this species.[1]

References

  1. ^ a b c d e f g h i j k l m Smith, W.D., J.J. Bizzarro and J. Lamilla (2006). Dasyatis dipterura. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved March 1, 2009.
  2. ^ Jordan, D.S. and C.H. Gilbert (May 1880). "Notes on a collection of fishes from San Diego, California". Proceedings of the United States National Museum 3 (106): 23–34. 
  3. ^ Garman, S. (October 1880). "New species of selachians in the museum collection". Bulletin of the Museum of Comparative Zoology 6 (11): 167–172. 
  4. ^ Garman, S. (September 1913). "The Plagiostomia (sharks, skates, and rays". Memoirs of the Museum of Comparative Zoology 36: 1–515. 
  5. ^ a b Eschmeyer, W. N. (ed.) dipterurus, Dasybatus. Catalog of Fishes electronic version (February 19, 2010). Retrieved on March 25, 2010.
  6. ^ a b c d e f g h i j k l m Ebert, D.A. (2003). Sharks, Rays, and Chimaeras of California. University of California Press. pp. 217–219. ISBN 0-520-23484-7. 
  7. ^ a b c Nishida, K. and K. Nakaya (1990). "Taxonomy of the genus Dasyatis (Elasmobranchii, Dasyatididae) from the North Pacific." in Pratt, H.L., S.H. Gruber and T. Taniuchi. Elasmobranchs as living resources: advances in the biology, ecology, systematics, and behaviour, and the status of fisheries. NOAA Technical Report, NMFS 90. pp. 327–346.
  8. ^ Rosenberger, L.J.; Schaefer, S. A. (August 6, 2001). "Phylogenetic Relationships within the Stingray Genus Dasyatis (Chondrichthyes: Dasyatidae)". In Schaefer, S. A. Copeia 2001 (3): 615–627. doi:10.1643/0045-8511(2001)001[0615:PRWTSG]2.0.CO;2. 
  9. ^ Froese, Rainer, and Daniel Pauly, eds. (2010). "Dasyatis dipterura" in FishBase. March 2010 version.
  10. ^ a b Peterson, R.T., W.N. Eschmeyer and E.S. Herald (1999). A Field Guide to Pacific Coast Fishes: North America. Houghton Mifflin Harcourt. pp. 54–55. ISBN 0-618-00212-X. 
  11. ^ a b Jordan, D.S. and B.W. Evermann (1896). The Fishes of North and Middle America (Part 1). Government Printing Office. p. 85. 
  12. ^ McClane, A.J. (1978). McClane's Field Guide to Saltwater Fishes of North America. Macmillan. p. 41. ISBN 0-8050-0733-4. 
  13. ^ a b c d Grove, J.S. and R.J. Lavenberg (1997). The Fishes of the Galápagos Islands. Stanford University Press. pp. 116–118. ISBN 0-8047-2289-7. 
  14. ^ Strand, S. (May 18, 1988). "Following Behavior: Interspecific Foraging Associations among Gulf of California Reef Fishes". Copeia (American Society of Ichthyologists and Herpetologists) 1988 (2): 351–357. doi:10.2307/1445875. JSTOR 1445875. 
  15. ^ Ghoshroy, S. and J.N. Caira (April 2001). "Four new species of Acanthobothrium (Cestoda : Tetraphyllidea) from the whiptail stingray Dasyatis brevis in the Gulf of California, Mexico". Journal of Parasitology 87 (2): 354–372. doi:10.1645/0022-3395(2001)087[0354:FNSOAC]2.0.CO;2. PMID 11318566. 
  16. ^ Ruhnke, T.R. and H.B. Seaman (2009). "Three new species of Anthocephalum Linton, 1890 (Cestoda: Tetraphyllidea) from dasyatid stingrays of the Gulf of California". Systematic Parasitology 72 (2): 81–95. doi:10.1007/s11230-008-9170-6. PMID 19115083. 
  17. ^ Campbell, R.A. and I. Beveridge (July 2007). "A new species and new records of Parachristianella Dollfus, 1946 (Cestoda : Trypanorhyncha) from the Gulf of California, Mexico". Comparative Parasitology 74 (2): 218–228. doi:10.1654/4261.1. 
  18. ^ Campbell, R.A. and I. Beveridge (December 2006). "Two new species of Pseudochristianella Campbell & Beveridge, 1990 (Cestoda : Trypanorhyncha) from Elasmobranch fishes from the Gulf of California, Mexico". Parasite-Journal de la Societe Francaise de Parasitologie 13 (4): 275–281. 
  19. ^ Curran, S.S., C.K. Blend and R.M. Overstreet (2003). "Anaporrhutum euzeti sp. n. (Gorgoderidae: Anaporrhutinae) from rays in the Gulf of California, Mexico". In Combes, C. and J. Jourdane. Taxonomy, Ecology and Evolution of Metazoan Parasites. Presses universitaires de Perpignan. pp. 225–234. ISBN 2-914518-36-6. 
  20. ^ Markell, E.K. (February 1956). "Probolitrema mexicana, n. sp., an Anaporrhutine Trematode from Elasmobranchs of Baja California". Journal of Parasitology (The American Society of Parasitologists) 42 (1): 56–59. JSTOR 3274623. 
  21. ^ Bullard, S.A. and R.R. Payne and J.S. Braswell (2004). "New genus with two new species of capsalid monogeneans from dasyatids in the Gulf of California". Journal of Parasitology 90 (6): 1412–1427. doi:10.1645/GE-304R. PMID 15715238. 
  22. ^ a b c d Smith, W.D. G.M. Cailliet and E.M. Melendez (2007). "Maturity and growth characteristics of a commercially exploited stingray, Dasyatis dipterura". Marine and Freshwater Research 58 (1): 54–66. doi:10.1071/MF06083. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!