Overview

Comprehensive Description

Biology

Inhabits strong current in deep (1-2.5 m) chutes and main channels of medium to large rivers over bedrock, sand and gravel (Ref. 5723).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (200,000 to >2,500,000 square km (about 80,000 to >1,000,000 square miles)) This sucker occupies Gulf Slope drainages from the Sabine River to the Rio Grande/Pecos River drainage, in Texas, New Mexico, and Mexico; the Mississippi River basin north to Wisconsin and Minnesota; the Missouri River drainage northwestward to the Dakotas and Montana; the Ohio River drainage eastward to western Pennsylvania (extirpated in Pennsylvania) (Burr and Mayden 1999), and the Tennessee River basin to eastern Tennessee and northern Alabama. It is now seemingly common only in the Missouri and Neosho rivers and middle Rio Grande (Etnier and Starnes 1993, Cross and Collins 1995), and in the Mississippi River south of the Missouri River in Missouri (Pflieger 1997). The Rio Grande population is to be described as a distinct species (Buth and Mayden 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America: Mississippi River basin from Pennsylvania to central Montana and south to Louisiana, USA; Gulf Slope drainages in the USA from Mobile Bay, Alabama to Rio Grande in Texas and New Mexico, and in Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 93 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 930 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

93.0 cm TL (male/unsexed; (Ref. 5723)); max. reported age: 13 years (Ref. 12193)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Largest rivers and lower parts of major tributaries. Usually in channels and flowing pools with moderate current (1.0-2.6 m/sec). Also in some impoundments. Adults probably winter in deep pools. Young in shallower and less swift water than adults.

Migrates upstream to spawn on riffles. In Kansas, spawned in deep riffles (1-2 m) with cobble and bedrock substrate (Moss et al. 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Migrates upstream into riffle areas for spawning (Becker 1983). Individuals may move more than 100 miles between spawning and nonspawning habitats (Mettee et al. 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Bottom feeder. Eats insects, crustaceans, and plant material, including algae (Becker 1983); also Sphaerium clams. Diet of adults and young often includes larvae and pupae of midges and caddisflies and plant material (see Sublette et al. 1990 and Moss et al. 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: This species is known from hundreds of sites in dozens of rivers (Burr and Mayden 1999), but the viability of many of these occurrences is unknown. Robison and Buchanan (1988) mapped 26 collection sites in Arkansas; only 1 collection was pre-1960. Etnier and Starnes (1993) mapped 23 collection sites, representing probably at least a dozen distinct occurrences, in Tennessee, but they stated that recent Tennessee records are scarce. Boschung and Mayden (2004) recorded only two records in the Tennessee River drainage in Alabama, one in 1939 and the other in 1993 [labeled "1997" on their map]. Burr and Warren (1986) mapped a few dozen collection sites scattered throughout the historical range in Kentucky. Pflieger (1997) mapped about 60 collection sites in Missouri, only a few of which were pre-1945; these represent three substantial populations in the Missouri River, Mississippi River, and lowland Ft. Francis River, plus smaller populations elsewhere. Only one river in Mexico (Rio Bravo) is believed to contain a viable population (Miller 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total population size is unknown but presumably exceeds 10,000. This species is common in preferred habitat in some areas. This fish's habitat makes it difficult to capture, so it is relatively rare in collections and abundance is easily underestimated (Burr and Warren 1986, Robison and Buchanan 1988, Etnier and Starnes 1993). In Arkansas, it is frequently caught in commercial fisheries, sometimes as many as 100 individuals per day in spring (Robison and Buchanan 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Spawns in spring (in May at water temperatures of 20-23 in Kansas). Males are sexually mature at age III-IV, females usually at age VI in Mississippi River. In Kansas, females lived to 9 years, males to 7 years (Moss et al. 1983). See Yeager and Semmens (1987) for a description of early developmental stages.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cycleptus elongatus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC3900-07|NC_008645|Cycleptus elongatus| ACGCGCTGATTCTTCTCTACCAACCACAAAGACATTGGCACCCTCTATCTTGTATTTGGTGCCTGAGCCGGAATAGTAGGAACCGCCTTA---AGCCTCCTAATCCGGGCCGAACTAAGTCAACCCGGCTCGCTTCTCGGCGAT---GATCAAATTTATAATGTCATCGTTACTGCCCACGCCTTCGTTATAATCTTCTTTATAGTAATACCCATCCTAATTGGGGGCTTTGGGAACTGACTTGTACCACTAATG---ATTGGAGCCCCGGATATAGCATTCCCCCGAATAAATAACATAAGCTTTTGACTTCTACCACCCTCATTCCTCCTACTACTGGCCTCCTCCGGAGTTGAAGCCGGGGCTGGAACAGGATGAACAGTATACCCCCCACTCGCAGGAAACCTCGCCCACGCCGGGGCTTCTGTAGATCTA---ACTATTTTCTCTCTCCACCTAGCAGGTGTTTCATCAATCCTTGGAGCCATTAACTTTATTACCACAACAATTAATATGAAACCCCCAGCTATCTCTCAATATCAGACACCTCTATTTGTTTGATCCGTTTTAGTGACGGCCGTTCTTCTTCTTTTATCCCTGCCTGTTTTAGCTGCG---GGAATTACTATACTATTAACGGACCGAAACCTAAACACAACATTCTTTGATCCTGCAGGAGGTGGAGACCCAATCCTCTATCAGCACTTATTTTGATTCTTCGGCCATCCAGAGGTATATATTCTTATTCTACCCGGATTTGGTATTATCTCCCACGTTGTAGCCTACTACGCCGGTAAAAAA---GAACCATTTGGCTACATGGGTATAGTATGAGCTATAATGGCAATCGGCCTCCTAGGTTTTATTGTGTGAGCCCATCACATGTTCACTGTTGGGATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cycleptus elongatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Species: 5
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LR/nt
Lower Risk/near threatened

Red List Criteria

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Gimenez Dixon, M.

Reviewer/s

History
  • 1994
    Rare
    (Groombridge 1994)
  • 1990
    Rare
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Wide distribution in large rivers in central North America; locally common in some areas, but greatly reduced in abundance in other parts of the range as a result of dam construction and reductions in water quality.

Environmental Specificity: Narrow. Specialist or community with key requirements common.

Other Considerations: As of 2001, among 23 states in the range, ranks are SR?, SH, S1, S2, or S3; not S4 or S5 anywhere.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: Over the past 10 years or three generations, this species apparently has declined in abundance and possibly also in number of subpopulations and area of occupancy. However, better information on current status is needed.

Global Long Term Trend: Decline of 50-70%

Comments: Over the long term, the blue sucker has become less common in some parts of its range, but it is still common and widely distributed in other areas.

This sucker is still common in the Missouri and Mississippi rivers in Missouri, but it was far more common in the upper Mississippi River prior to 1900 than since (Pflieger 1997). As of the 1980s, the Arkansas River population in Arkansas was relatively stable and large (Robison and Buchanan 1988). Cross and Collins (1995) noted that the species declined long ago over much of its range, but fairly large numbers remain in the Neosho River in Kansas. Burr and Mayden (1999) characterized this fish as "uncommon and disappearing at the edges of its range," but "reproducing and showing evidence of recruitment at many localities" and "clearly not jeopardized throughout all or a significant portion of its range." Warren et al. (2000) categorized the status in the southeastern United States as Vulnerable ("a species or subspecies that may become endangered or threatened by relatively minor disturbances to its habitat or that deserves careful monitoring of its distribution and abundance in continental waters of the United States to determine its status"). Boschung and Mayden (2004) stated that "although the blue sucker may be locally common in places, it is presently imperiled throughout much of its range...."

In Kentucky, Burr and Warren (1986) reported the blue sucker as occasional and locally common at the Falls of the Ohio in Jefferson County, the main channel of the lower Green River, and the lower Licking River (where recent collections yielded numerous specimens). Occurrence was reported as sporadic in the Ohio River, the lower Tennessee River below Kentucky Dam, and the lower Kentucky River; formerly present in the Cumberland River. At that time, the authors recommended that it be delisted from its threatened status in Kentucky.

Sublette et al. (1990) stated that the blue sucker has been extirpated from the Rio Grande but is stable in the lower Pecos River drainage below Brantley Reservoir in New Mexico. Subsequently, Burr (pers. comm., 1995, cited by Miller 2005) reported it as rare in the main stem Rio Grande.

Miller (2005) mapped 10 collection localities in Mexico, including some along the Rio Grande, but he noted that except in the middle Rio Bravo in the vicinity of Big Bend National Park, where the species remains common, this sucker may be extirpated from Mexico.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Cited causes of decline include historical overfishing, depletion of surface water, poor water quality stemming from sewage effluent and agricultural runoff, siltation from poor farming practices, interruption of migrations by dams, and stranding in irrigation canals (Coker 1930, Robison and Buchanan 1988, Sublette et al. 1990, Pflieger 1997, Boschung and Mayden 2004). Declines following droughts were noted by Moss et al. (1983). Reductions in river velocity could also inhibit reproductive success (Eberle 1993:2). This fish tolerates high turbidity if sufficient current prevents silt deposition (Pflieger 1997). Threats are difficult to alleviate.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lower Risk: near threatened (LR/nt)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Restoration Potential: "It seems unlikely that its plight will improve" (Etnier and Starnes 1993).

Biological Research Needs: Further information is needed on systematics, life history, and migration.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Needs: Protection needs include: enforcement of water quality standards; maintenance of perennial flows in streams; protection of spawning habitat; construction of fishways to allow passage of migrating fish past dams.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: One of the finest freshwater food fishes; formerly an important part of commercial fisheries in Mississippi drainage (Sublette et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Blue sucker

The blue sucker, Cycleptus elongatus, is a freshwater species of fish in the sucker family. Color is variable, from light steel-gray to almost black. The fish is streamlined, with a pointed head and a subterminal mouth. Huge migrations of these fast, powerful fish once migrated throughout the Mississippi River basin, and spring harvests of blue sucker were a staple food for early pioneers. Blue suckers are very rare today, thought to be due to the segmentation of habitat caused by the thousands of dams which have been built in the last century. Blues frequent the thalweg of large river systems, in heavy current. Early records indicate that this fish once reached weights of over 40 lb, although 15-pounders are quite rare today.

Blue suckers eat aquatic insect larvae, crustaceans, plant materials and algae.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: One of only a few species in the subfamily Cycleptinae (two in North America, the other in China) (Burr and Mayden 1999). Cycleptus meridionalis of the Alabama-Pascagoula drainages formerly was included in C. ELONGATUS. The Rio Grande population of C. ELONGATUS apparently warrants recognition as a distinct species, to be described by Mayden and Burr (Buth and Mayden 2001). See Smith (1992) for a study of the phylogeny and biogeography of the Catostomidae.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!