Overview

Comprehensive Description

Biology

Inhabits virtually any body of water, standing or flowing, large or small (Ref. 5723). Most common in gravel-bottom pools and runs of streams and along rocky lake margins (Ref. 5723). Mostly in shallow water, but may move to deeper parts of lakes during hot weather (Ref. 27547). Feeds on zooplankton, algae, terrestrial and aquatic insects, and small fishes (Ref. 1998).
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The most northern minnow in North America; the only minnow in Alaska (Page and Burr 2011). Range includes much of Canada and the extreme northern United States, south to Delaware River of New York, Lake Michigan (Illinois), and Platte River system in Wyoming, with relict populations in the upper Missouri River drainage, South Dakota, Nebraska, Colorado, and Wyoming, and Twin Springs Creek (Mississippi River tributary), Iowa (Stasiak 1986, Bestgen et al. 1991, Page and Burr 2011).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) The most northern minnow in North America; the only minnow in Alaska (Page and Burr 2011). Range includes much of Canada and the extreme northern United States, south to Delaware River of New York, Lake Michigan (Illinois), and Platte River system in Wyoming, with relict populations in the upper Missouri River drainage, South Dakota, Nebraska, Colorado, and Wyoming, and Twin Springs Creek (Mississippi River tributary), Iowa (Stasiak 1986, Bestgen et al. 1991, Page and Burr 2011).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: Alaska (Yukon River drainage). Throughout most of Canada and northern USA; south to Delaware River in New York, south end of Lake Michigan, Illinois, Platte River system in Colorado, and Columbia River drainage in Washington, USA. Relict population in Mississippi River basin in Iowa, USA. Sometimes hybridizes with Rhinichthys cataractae in Lake Superior (Ref. 4564).
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Alaska, Canada, mainland U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 8; Analspines: 0; Analsoft rays: 7 - 9; Vertebrae: 39 - 44
  • Morrow, J.E. 1980 The freshwater fishes of Alaska. University of. B.C. Animal Resources Ecology Library. 248p. (Ref. 27547)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 23 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 230 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

23.0 cm TL (male/unsexed; (Ref. 5723)); max. reported age: 5 years (Ref. 12193)
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
  • Hugg, D.O. 1996 MAPFISH georeferenced mapping database. Freshwater and estuarine fishes of North America. Life Science Software. Dennis O. and Steven Hugg, 1278 Turkey Point Road, Edgewater, Maryland, USA. (Ref. 12193)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Distinguished by the spineless fins, normal jaws, and tiny barbel at the corner of the mouth (Ref. 27547). Gill rakers short (Ref. 27547). Caudal moderately forked, with rounded lobes (Ref. 27547). Brown to greenish above, silvery below; a rather indistinct dark or lead-colored band is present along the sides, often extending forward onto the head of small specimens; lower sides and belly often have fine dots of dark pigment (Ref. 27547). In some populations, breeding males develop bright orange-red patches on sides of head and at bases of pectoral fins, but the presence of this color varies from place to place (Ref. 27547).
  • Morrow, J.E. 1980 The freshwater fishes of Alaska. University of. B.C. Animal Resources Ecology Library. 248p. (Ref. 27547)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Syntype for Couesius plumbeus
Catalog Number: USNM 160
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): Suckley
Locality: Little Muddy R., Montana, United States, North America
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Couesius plumbeus
Catalog Number: USNM 158
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Dry Osteological Specimen
Collector(s): Suckley
Locality: Milk River, Montana, United States, North America
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Couesius plumbeus
Catalog Number: USNM 159
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Dry Osteological Specimen
Collector(s): Suckley
Locality: Little Muddy R., Montana, United States, North America
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Gobio plumbeus
Catalog Number: USNM 120262
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Photograph
Year Collected: 1848
Locality: Sault St Marie, Mich, Michigan, United States, North America
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Gobio plumbeus
Catalog Number: USNM 117540
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Agassiz
Year Collected: 1848
Locality: Lake Superior, United States, North America
  • Syntype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Columbia River Demersal Habitat

This taxon is one of a number of demersal species in the Columbia River system. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton. The Columbia River is the largest North American watercourse by volume that discharges to the Pacific Ocean. With headwaters at Columbia Lake, in Canadian British Columbia, the course of the river has a length of approximately 2000 kilometers and a drainage basin that includes most of the land area of Washington, Oregon and Idaho as well as parts of four other U.S. states and two Canadian provinces.

The Columbia River Basin of northwestern North America is an important habitat for Acipenser transmontanus. The Columbia River is the largest North American watercourse by volume that discharges to the Pacific Ocean. With headwaters at Columbia Lake, in Canadian British Columbia, the course of the river has a length of approximately 2000 kilometers and a drainage basin that includes most of the land area of Washington, Oregon and Idaho as well as parts of four other U.S. states and two Canadian provinces.

The hydrology and aquatic habitat of the Columbia River basin has been adversely altered by numerous large dams. There are over 250 reservoirs and around 150 hydroelectric projects in the basin, including 18 mainstem dams on the Columbia and its main tributary, the Snake River.

Water quality in the Columbia River has deteriorated over the last century, due to agricultural runoff and logging practices, as well as water diversions that tend to concentrate pollutants in the reduced water volume. For example nitrate levels in the Columbia generally tripled in the period from the mid 1960s to the mid 1980s, increasing from a typical level of one to three milligrams per liter. Considerable loading of herbicides and pesticides also has occurred over the last 70 years, chiefly due to agricultural land conversion and emphasis upon maximizing crop yields.

Heavy metal concentrations in sediment and in fish tissue had become an issue in the latter half of the twentieth century; however, considerable progress has been made beginning in the 1980s with implementation of provisions of the U.S.Clean Water Act, involving attention to smelter and paper mill discharges along the Columbia.

Some large demersal fish species occurring in the Columbia Basin are the 610 centimeter (cm) white sturgeon (Acipenser transmontanus), the 76 cm Pacific lamprey (Lampetra tridentata); the 55 cm Brown bullhead (Ameiurus nebolosus); the 61 cm largescale sucker (Catostomus macrocheilus); the 64 cm longnose sucker (Catostomus catostomus catostomus); and the 65 cm Utah sucker (Catostomus ardens).

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat and Ecology

Habitat and Ecology
This chub occurs in varied habitats, including standing or flowing water, and large or small bodies of water; it is most common in gravel-bottomed pools and runs of streams and along rocky lake margins (Page and Burr 2011). It is more common in lakes in the southern part of the range, mostly in rivers in the north (but in lakes if available). Often it occurs in shallows but may move into deeper parts of lakes in summer. Spawning occurs in river shallows, along rocky shores, in shoals of lakes.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: This chub occurs in varied habitats, including standing or flowing water, and large or small bodies of water; it is most common in gravel-bottomed pools and runs of streams and along rocky lake margins (Page and Burr 2011). It is more common in lakes in the southern part of the range, mostly in rivers in the north (but in lakes if available). Often it occurs in shallows but may move into deeper parts of lakes in summer. Spawning occurs in river shallows, along rocky shores, in shoals of lakes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; freshwater; pH range: 6.5 - 7.8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 248 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0.075 - 37

Graphical representation

Depth range (m): 0.075 - 37
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

May migrate up to 1.6 km between separate spawning and nonspawning habitats (Scott and Crossman 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits virtually any body of water, standing or flowing, large or small (Ref. 5723). Most common in gravel-bottom pools and runs of streams and along rocky lake margins (Ref. 5723). Mostly in shallow water, but may move to deeper parts of lakes during hot weather (Ref. 27547). Feeds on zooplankton, algae, terrestrial and aquatic insects, and small fishes (Ref. 1998). Feeds on fish, plants and insects (Ref. 1998).
  • Scott, W.B. and E.J. Crossman 1973 Freshwater fishes of Canada. Bull. Fish. Res. Board Can. 184:1-966. (Ref. 1998)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats insect larvae, zooplankton, and algae; sometimes fishes (Scott and Crossman 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a very large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total adult population size is unknown but very large.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Sometimes occurs in large schools (Becker 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Spawning individuals form schools that move from lakes or deeper parts of streams to shallower water (Ref. 27547). Also Ref. 10280.
  • Morrow, J.E. 1980 The freshwater fishes of Alaska. University of. B.C. Animal Resources Ecology Library. 248p. (Ref. 27547)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Spawns in spring and summer. Eggs hatch in about 10 days. Sexually mature in 3rd or 4th year (Becker 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Couesius plumbeus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTTGTATTTGGTGCCTGAGCCGGAATAGTAGGGACTGCCCTAAGCCTTCTTATTCGGGCCGAATTAAGCCAACCTGGGTCATTATTAGGTGATGACCAAATTTATAACGTCATCGTTACCGCCCACGCCTTCGTAATAATTTTCTTTATAGTAATGCCAATTCTTATTGGGGGATTCGGAAACTGACTCGTACCACTAATGATTGGTGCACCAGACATGGCGTTCCCGCGAATAAACAATATAAGCTTCTGACTTCTACCCCCGTCATTCCTGCTACTACTGGCCTCCTCTGGAGTCGAAGCCGGGGCTGGGACAGGCTGAACAGTATATCCTCCACTCTCAGGTAATCTCGCTCACGCCGGCGCATCAGTAGACCTAACAATTTTCTCCCTTCATCTAGCAGGTGTATCATCAATTTTAGGTGCTGTTAATTTTATTACTACTATTATTAATATGAAACCCCCAGCCATCTCCCAATATCAAACACCTCTCTTTGTATGGGCCGTGCTTGTAACAGCTGTTCTTCTTCTCCTGTCATTGCCAGTTCTAGCTGCTGGAATTACAATACTTCTTACAGACCGAAACCTTAACACCACATTCTTTGATCCAGCAGGAGGGGGAGACCCAATCCTATACCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Couesius plumbeus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
This species is listed as Least Concern in view of the large extent of occurrence, large number of subpopulations, large population size, apparently stable trend, and lack of major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a very large number of occurrences (subpopulations).

Total adult population size is unknown but very large.

Trend over the past 10 years or three generations is uncertain but likely to be relatively stable.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Trend over the past 10 years or three generations is uncertain but likely relatively stable.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: No major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: public aquariums; bait: occasionally
  • Scott, W.B. and E.J. Crossman 1973 Freshwater fishes of Canada. Bull. Fish. Res. Board Can. 184:1-966. (Ref. 1998)
  • Newman, L. 1995 Census of fish at the Vancouver aquarium, 1994. Unpublished manuscript.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lake chub

The lake chub, Couesius plumbeus, is a freshwater cyprinid fish found in Canada and in parts of the United States. Of all North American minnows, it is the one with the northernmost distribution. Its genus, Couesius is considered monotypic today. The genus was named after Dr. Elliott Coues, who collected the holotype specimen.

Description[edit]

The body is elongate, usually 100 mm (4 in) long, though some individuals twice that length have been found. The back is olive-brown or dark brown, and the sides are leaden silver, hence the word plumbeus, referring to lead, in the scientific name of this fish. The snout is blunt and projects slightly beyond the upper lip. The corners of the mouth each bear a small barbel. The scales are small but well visible, and some may be black and form isolated dark spots on the lower sides. The dorsal, pelvic and anal fins each have 8 rays. The pectoral fins are broad and have 13-18, but more usually 15-16, rays. Breeding males can develop patches of bright orange or red at the base of the pectoral fins and sometimes near the mouth, and small nuptial tubercles on the top of the head, dorsal surface of pectoral rays, and on the belly near the base of the pectorals.

Distribution[edit]

The lake chub is generally found throughout Canada up to the Arctic Circle. Some scattered populations are also present in the northern United States, more precisely in New England, Michigan, Iowa, Wisconsin, Minnesota, the Dakotas, Montana, Wyoming, Colorado, Washington, Idaho and Utah.

Habitat[edit]

As its common name implies, the lake chub is most commonly found in lakes, but it can also live in rivers and streams. In mid-summer it may move to the deeper parts of a lake to avoid the warmer waters of the lake shore.

Diet[edit]

The diet of the lake chub is varied: zooplankton, insects, aquatic insect larvae, and algae. The largest individuals can capture small fishes. The lake chub itself can be eaten by large predatory fishes and is therefore suitable as bait for fishing.

Growth[edit]

In and around Catamaran Brook, New Brunswick, Canada, lake chubs over 5 cm long (2 inches) were found to grow by about 0.8 cm (0.3 inch) a month in summer.[1]

Reproduction[edit]

Lake chubs normally undergo spawning migrations in early summer. Temperature plays a role in triggering migration onset, as migrations are delayed on colder years.[1] Migrating chubs leave their lakes and rivers to ascend tributary streams, in which they mate (by day or night) and release their eggs over gravel or rocks.[2] There is no parental care. During migration the fish move mostly during dusk and at night.[1]

Behaviour[edit]

In the laboratory, lake chubs have expressed free-running circadian rhythms that are among the most precise of the few fish species studied to date.[3] These fish are usually diurnal in the laboratory, but in the wild they can be diurnal, crepuscular, or nocturnal.[4]

The lake chub has large optic lobes in its brain and is therefore presumed to be a good sight feeder.[5] It can, however, feed at night also.[6] Comparisons with other freshwater fishes such as stickleback, northern pike, sculpin, and burbot have revealed that it has a superior hearing capacity.[7]

Common name[edit]

The lake chub must not be confused with various cisco species of the genus Coregonus living in Lake Michigan, which are often called Michigan Lake chubs.

The lake chub is sometimes called by other names such as northern chub, lake northern chub, chub minnow, plumbeus minnow, or bottlefish. The species is also found in Quebec and its French name is "mené de lac".

References[edit]

  1. ^ a b c Reebs, S.G., S. Leblanc, A. Fraser, P. Hardie, & R.A. Cunjak, 2008, Upstream and downstream movements of lake chub, Couesius plumbeus, and white sucker, Catostomus commersoni, at Catamaran Brook, 1990-2004. Canadian Technical Report of Fisheries and Aquatic Sciences 2791.
  2. ^ Brown, J.H., Hammer, U.T., and Koshinsky, G.D., 1970, Breeding biology of the lake chub, Couesius plumbeus, at Lac la Ronge, Saskatchewan, Journal of the Fisheries Research Board of Canada 27: 1005-1015.
  3. ^ Kavaliers, M., 1978, Seasonal changes in the circadian period of the lake chub, Couesius plumbeus, Canadian Journal of Zoology 56: 2591-2596; Kavaliers, M., 1979, Pineal involvement in the control of circadian rhythmicity in the lake chub, Couesius plumbeus, Journal of Experimental Zoology 209: 33-40; Kavaliers, M., 1979, The pineal organ and circadian organization of teleost fish, Revue Canadienne de Biologie 38: 281-292.
  4. ^ Reebs, S.G., 2002, Plasticity of diel and circadian activity rhythms in fishes, Reviews in Fish Biology and Fisheries 12: 349-371.
  5. ^ Davis, B.J., and Miller, R.J., 1967, Brain patterns in minnows of the genus Hybopsis in relation to feeding habits and habitats, Copeia 1967: 1-39
  6. ^ Emery, A.R., 1973, Preliminary comparisons of day and night habits of freshwater fish in Ontario lakes, Journal of the Fisheries Research Board of Canada 30: 761-774.
  7. ^ Mann, D.A., Cott, P.A., Hanna, B.W., and Popper, A.N., 2007, Hearing in eight species of northern Canadian freshwater fishes, Journal of Fish Biology 70: 109-120.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Monotypic genus. Formerly included in the genera Hybopsis and Semotilus (Lee et al. 1980). Three subspecies have been recognized: plumbeus, greeni, and dissimilis.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!