Overview

Comprehensive Description

Biology

Inhabit lakes and large rivers (Ref. 4967). Occur in shallow water with muddy bottom. Omnivore, feed on plankton, mollusks, seeds and detritus (Ref. 13868). Oviparous (Ref. 205). Nested eggs are guarded by the male parent (Ref. 47642). Furthermore, the male plays host to eggs and young of Dinotopterus cunningtoni which takes advantage of the already prepared nest and feed on the host brood (Ref. 49546). An example of interspecific brood care.
  • Risch, L.M. 2003 Claroteidae. p. 60-96 In C. Lévêque, D. Paugy and G.G. Teugels (eds.) Faune des poissons d'eaux douce et saumâtres de l'Afrique de l'Ouest, Tome 2. Coll. Faune et Flore tropicales 40. Musée Royal de l'Afrique Centrale, Tervuren, Belgique, Museum National d'Histoire Naturalle, Paris, France and Institut de Recherche pour le Développement, Paris, France. 815 p. (Ref. 57126)   http://www.fishbase.org/references/FBRefSummary.php?id=57126&speccode=2438 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Auchenoglanis occidentalis is a demersal, potamodromous species. It inhabits lakes and large rivers across much of Africa.

Central Africa: Auchenoglanis occidentalis is known from throughout the Congo River basin. It is also known from the Cross River in Cameroon.

Eastern Africa: This species is present in Lake Tanganyika and major affluent rivers, including Rusizi and Malagarasi, as well as Lakes Albert and Edward. It is found in the Blue and White Niles, Aswa river, Omo River, Lake Turkana and Giuba River.

Northern Africa: This species is now rare in This species is known from upper Egyptian Nile (Luxor and Aswan).

Northeast Africa: It is found in Setit in Eritrea and the Ghazal and jebel systems in Sudan. It is also known from Baro, Omo and Wabishebelle Rivers in Ethiopia.

Western Africa: This species is known from the Chad basin, the Niger, Senegal, and Gambia, where it is sympatric with Auchenoglanis biscutatus. Also occurs in the Volta basin, in Ivorian basins of the Comoe, Bandama and Sassandra, Casamance (Senegal), Géba and Corubal (Guinea), Jong and Moa (Sierra Leone) and in the River Cross. It has also been mentioned from the Ogun in Nigeria and from southern Ghana. It should be noted that this species has never been observed in large quantities in forested areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Africa: present in most rivers of West Africa, Lake Chad, the entire Congo River system, the Nile, East African lakes, and the rivers Omo and Giuba.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 1; Dorsal soft rays (total): 7 - 8; Anal spines: 3 - 4; Analsoft rays: 7 - 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 700 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

70.0 cm SL (male/unsexed; (Ref. 4967))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Head large with heavily built body (Ref. 4967). Marbled or spotted gray, with a few black spots arranged in rows.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Auchenoglanis occidentalis is a demersal, potamodromous species. This species is found in inshore areas of lakes and major rivers, sometimes in swamps of flood plains (Eccles 1992). This species occurs in shallow waters with muddy bottoms. It is an omnivore and feeds on insect larvae, worms, crustacea, molluscs other invertebrates, but also on plankton, seeds, plants and detritus (Willoughby 1974, Bailey 1994). Auchenoglanis occidentalis is oviparous (Breder and Rosen 1966). The breeding season extends from May to October, and nested eggs are guarded and brooded by the male parent (Ochi et al. 2001). Furthermore, the male plays host to eggs and young of Dinotopterus cunningtoni which takes advantage of the already prepared nest and feeds on the host brood (Ochi et al. 2001). This is an example of interspecific brood care.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; potamodromous (Ref. 51243); freshwater; pH range: 6.5 - 7.8; dH range: 28
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeds on detritus, plants, mollusks and other invertebrates (Ref. 13868).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Sanguinicola Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bagrobdella Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Allocreadium Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Eggs are brooded and guarded by the male parent (Ref. 47642).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Auchenoglanis occidentalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACGATCACACGCTGATTTTTCTCAACCAACCATAAAGATATCGGCACCCTCTATTTAGTATTTGGTGCCTGAGCCGGAATAGTTGGCACAGCCCTCAGCCTACTAATTCGAGCTGAGTTAGCCCAACCTGGAGCCCTTCTAGGCGATGACCAAATTTACAATGTAATTGTCACCGCCCATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATCGGGGGGTTTGGAAATTGACTCGTCCCACTAATAATTGGAGCGCCCGATATAGCATTTCCACGAATAAATAACATAAGCTTTTGGCTACTACCACCCTCCTTCCTACTACTTCTCTCCTCATCTGGAGTTGAAGCTGGGGCAGGGACAGGATGAACCGTCTACCCCCCACTTGCCGGCAATATTGCACATGCTGGAGCCTCTGTAGATCTAACTATCTTCTCTCTTCACCTGGCAGGTGTATCATCTATTCTAGGAGCAATCAACTTCATCACAACTATTATCAATATAAAACCCCCAGCCATCTCACAATACCAGACACCTCTATTCGTATGGGCTATCCTAATTACAGCTGTCCTTTTATTACTATCCCTCCCAGTACTAGCCGCCGGTATTACAATACTGCTAACAGACCGAAATCTAAATACCACCTTCTTTGACCCTGCAGGAGGTGGAGACCCAATCCTTTATCAACACCTTTTCTGATTCTTTGGTCATCCAGAAGTATACATTTTAATTTTACCAGGCTTTGGTATAATCTCCCACATCGTGGCTTACTATGCAGGTAAAAAAGAGCCATTCGGCTATATAGGAATAGTATGAGCTATAATGGCCATTGGTTTACTAGGCTTCATCGTCTGAGCCCACCACATATTCACTGTCGGAATAGACGTAGACACCCGAGCATACTTTACATCCGCCACAATAATTATTGCAATCCCGACGGGAGTAAAAGTCTTCAGCTGACTGGCCACTCTTCATGGAGGATCAATTAAATGAGAAACCCCGCTACTATGAGCCCTCGGCTTCATTTTCCTATTCACTGTTGGAGGACTCACTGGAATCGTTTTAGCTAATTCATCCCTAGACATCACACTTCATGACACCTATTATGTCGTAGCCCACTTCCACTATGTCCTATCAATGGGCGCAGTATTCGCCATTATGGGAGCCTTCGTCCACTGATTCCCTTTATTTACAGGATATACAATACACAGCACCTGAACAAAAATTCACTTCGGAACAATATTTGTGGGAGTAAACCTAACCTTTTTCCCACAACACTTCCTAGGCTTGGCCGGAATGCCCCGACGATACTCAGACTACCCAGACGCTTATGCACTATGAAACATTATCTCCTCAATTGGATCAATAGTATCCCTTGTGGCAGTCGTAATATTCCTTTATATCCTATGAGAAGCTTTCACCGCCAAACGAGAAGTCCTATCAGTCGAACTAACCCCAACAAATGCAGAATGACTACACGGGTGTCCACCCCCCTACCACACATTCGAAGAACCAGCTTTCGTACAAGTACAAACAAATTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Auchenoglanis occidentalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Azeroual, A., Entsua-Mensah, M., Getahun, A., Hanssens, M., Lalèyè, P. & Moelants, T.

Reviewer/s
Snoeks, J., Tweddle, D., Getahun, A., Lalèyè, P., Paugy, D., Zaiss, R., Fishar, M.R.A & Brooks, E.

Contributor/s

Justification
This species has a wide distribution, with no known major widespread threats. It is therefore listed as Least Concern. It has also been assessed regionally as Least Concern for central, east and west Africa. In northeast Africa it has been assessed as Data Deficient, and in north Africa it has been assessed as Vulnerable.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
No population estimate available but in eastern Africa the species is common in fisheries catches and on the markets around Rusizi and Malagarasi rivers deltas. Kenya's fisheries department believe the population is increasing in Lake Turkana.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
For the majority of its range, no major threats to this species are known. In eastern Africa, it is threatened by loss of flood plains and vegetated marshes around rivers and lakes due to agriculture extension, as well as overfishing. In north Africa, dams, water pollution (agriculture, domestic and commercial/industrial), groundwater extraction and drought all pose possible threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No information available. More research is needed into this species population numbers and range, biology and ecology, habitat status and threats, as well as monitoring and potential conservation measures.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Giraffe catfish

The giraffe catfish, Auchenoglanis occidentalis, is an African catfish. It eats plants off the floor of lakes and streams.

Contents

Distribution and habitat

The giraffe catfish is found throughout Africa in lakes and rivers, partially due to introduction and establishment in other areas.[1] It is found in many important lakes and rivers such as the Nile and Lake Chad. Its distribution covers includes bodies of water from East Africa to West Africa. It generally lives in shallow waters with muddy bottoms.[2]

Anatomy and appearance

This fish has a maximum size that sources say are between two and three feet.

The giraffe-like pattern will fade with age to a two-tone mottled brown. Various subspecies have been described for this fish, indicating some geographical variation in coloration.[1]

Reproduction

Eggs are scattered in a nest and guarded by the male. Dinotopterus cunningtoni takes advantage of the care and allows the male giraffe catfish to care for its eggs and young, an example of interspecific brood care.[2]

Relationship to humans

The giraffe catfish is occasionally imported for the aquarium trade. Because of its large eventual size and its fast rate of growth, it is inappropriate for smaller aquaria. This fish will readily accept a variety of foods and is tolerant of a wide variety of water conditions. They will scavenge the aquarium looking for food, which could cause in the uprooting of plants.[1]

This fish is also an important food fish in Africa.[1]

Notes

  1. ^ a b c d PlanetCatfish • Catfish of the Month • October 1999
  2. ^ a b "Auchenoglanis occidentalis". FishBase. http://www.fishbase.org/Summary/speciesSummary.php?ID=2438&genusname=Auchenoglanis&speciesname=occidentalis. Retrieved 1 March 2007.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!