Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Biology

Bathypelagic (Ref. 58426). Adults occur mainly between 500 and 2,000 m, but ranging from near the surface (young) to 5,000 m. Form schools, swim in small groups or solitary. Carnivorous (Ref. 27155), feeding on crustaceans when young and on fish mainly when adults (Ref. 4737). Serve as food for pelagic fishes such as tuna, albacore, and marlin (Ref. 5951). Oviparous, with planktonic larvae (Ref. 36624).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Azores Exclusive Economic Zone, European waters (ERMS scope), Gulf of Mexico, Gulf of St. Lawrence, Madagascar, Mozambique, New Zealand Exclusive Economic Zone, North West Atlantic, Portuguese Exclusive Economic Zone, South Africa (country), Spanish Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Worldwide in tropical to temperate seas. In the western Atlantic it is also known from the Flemish Cap (Ref. 5951).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Anoplogaster cornuta is found worldwide in tropical to temperate and subartctic seas, specifically within the range 65°N - 46°S, 180°W - 180°E. It is typically reported as a temperate to tropical species, though it has also been documented in the subarctic waters of the Pacific and Western Atlantic. It is native to at least 48 countries across the globe, and is found in regions such as Azores Exclusive Economic Zone, European waters, the Gulf of Mexico, Madagascar, Mozambique, New Zealand Exclusive Economic Zone, the north West Atlantic, South Africa, and the Spanish Exclusive Economic Zone. In Australia, A. cornuta has been observed from central to southern New South Wales.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); ethiopian (Native ); neotropical (Native ); australian (Native ); oceanic islands (Native ); indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Worldwide in temperate and warm waters; Western Atlantic: off northern Argentina and the Falkland Is. to Flemish Cap
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical through subarctic waters, including Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Fangtooths have shortened, deep bodies with characteristically large mouth lined with sharp, fang-like teeth from which the species gained its common name. Relative to body size, they have the largest teeth of any marine species, with one of their most prominent features being a pair of long anterior fangs in the upper jaw. The length of their teeth prohibits them from completely closing their mouth. They are uniformly dark brown to black in color, and most of their body is covered with thin, prickly scales and spines. Lateral lines are seen as distinctly open grooves on either side of the body, and are partially covered with scales at various intervals. They typically have between 17 and 20 dorsal soft rays, seven to nine anal soft rays, and 28 vertebrae. They lack both dorsal and anal spines. Swim bladders are present, and relative to most other deep-sea fish, fangtooths have powerful muscles. Fangtooths are sexually dimorphic as adult females tend to be larger than their male counterparts.

Juvenile and adult fangtooths exhibit vast morphological differences. Juveniles have a long cephalic and preopercular spine. Their eyes are large, but their teeth are small and are not found on the palatine or the vomer. However, they have multiserial teeth on their premaxilaries. Juvenile gill rakers are described as long and slender. They have long head spines and are more lightly colored than adults. In contrast, adults do not have cephalic or preopercular spines. Their eyes are comparatively small, and their gill-rakers are tooth-like and are found in groups with bony bases. Juveniles begin to look like adults when they reach approximately 8 cm in length, and adults generally grow to a length of 17 cm.

Anoplogaster cornuta is stenothermic and is adapted to temperatures between 4°C and 6ºC. Due to the depths at which adults are typically found, various mechanisms have been proposed for its survival under high hydrostatic pressure in the oxygen minimum layers of the ocean. One study found that there was a significant positive relationship between oxygen consumption rates and critical oxygen tension, leading to at least two possible explanations. One is that A. cornuta only occasionally visits the oxygen minimum zone and that it is capable of sustained oxygen debt during these visits. Alternatively, these organisms might only engage in anaerobic metabolism in the oxygen minimum zone.

Range length: 18 (high) cm.

Average length: 17 cm.

Other Physical Features: homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

  • Gordon, M. 1976. Comparative Studies on the Metabolism of Shallow-water and Deep-sea Marine Fishes. IV. Patterns of Aerobic Metabolism in the Mesopelagic Deep-sea Fangtooth Fish Anoplogaster cornuta. Marine Biology, 3: 287.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Dorsal spines (total): 0; Dorsal soft rays (total): 17 - 20; Analspines: 0; Analsoft rays: 7 - 9; Vertebrae: 28
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 152 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

18.0 cm TL (male/unsexed; (Ref. 5951))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body uniformly blackish or dark blackish brown (Ref. 27363). Lateral line an open groove, bridged by scales at intervals. Swim bladder present. Juveniles: long cephalic and preopercular spine; big eye; teeth on jaws small, multiserial on premaxilaries; no teeth on palatine and vomer; gill rakers long and slender. Adult: no cephalic and preopercular spines; eye small; gill rakers tooth-like in groups on bony bases.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Holotype for Caulolepis longidens Gill
Catalog Number: USNM 33270
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Year Collected: 1883
Locality: Atlantic Ocean, Cape Hatteras To Cape May, New Jersey, United States, Atlantic
Depth (m): 2462
Vessel: Albatross
  • Holotype: Gill, T. N. 1883. Proceedings of the United States National Museum. 6 (380): 258.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

bathypelagic; marine; depth range 2 - 4992 m (Ref. 50610), usually 500 - 2000 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Anoplogaster cornuta is an exclusively marine species and exists from bathypelagic to mesopalagic depths ranging from 2 m to 4992 m below sea level; however, it is most common between 500 m and 2000 m. Adults are commonly captured at depths ranging from 75 to 5000 m, juveniles at 45 to 3100 m, and larvae at 2 m or more.

Range depth: 4992 to 2 m.

Habitat Regions: temperate ; tropical ; saltwater or marine

Aquatic Biomes: pelagic

  • Fothergill, A. 2001. "Fangtooth in the Abyss - Blue Planet - BBC Wildlife" (On-line video). YouTube. Accessed February 24, 2011 at http://www.youtube.com/watch?v=_lOwi6upg4I.
  • Shimizu, T. 1978. Record of the Beryciform Fish, Anoplogaster cornuta, From the Western North Pacific. Jap. J. Ichthyol, 25: 65-67.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Adults occur mainly between 500 and 2,000 m, but ranging from near the surface (young) to 5,000 m. Form schools, swim in small groups or solitary.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 284 specimens in 1 taxon.
Water temperature and chemistry ranges based on 251 samples.

Environmental ranges
  Depth range (m): 0 - 3272
  Temperature range (°C): 2.336 - 21.844
  Nitrate (umol/L): 0.217 - 44.123
  Salinity (PPS): 33.836 - 36.675
  Oxygen (ml/l): 0.375 - 6.468
  Phosphate (umol/l): 0.033 - 3.191
  Silicate (umol/l): 0.798 - 150.414

Graphical representation

Depth range (m): 0 - 3272

Temperature range (°C): 2.336 - 21.844

Nitrate (umol/L): 0.217 - 44.123

Salinity (PPS): 33.836 - 36.675

Oxygen (ml/l): 0.375 - 6.468

Phosphate (umol/l): 0.033 - 3.191

Silicate (umol/l): 0.798 - 150.414
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 50 - 4900m.
From 50 to 4900 meters.

Habitat: bathypelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Bathypelagic (Ref. 58426). Adults at greater depths than juveniles. Young feed mainly on crustaceans. Adults feed on fish (Ref.4737). Contact chemoreception may be the primary system for sensing and locating prey organisms in which the fangtooth presumably scull slowly until it bumps into a potential prey (Ref. 40644).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Anoplogaster cornuta is carnivorous. Juveniles feed on crustaceans, while adults feed primarily on fish and shrimp. They have been observed to feed on fish one-third their size, necessitating the mechanism of reversed direction ventilation when feeding. Their large size allows them to swallow most prey whole. Due to their high mobility relative to other pelagic teleosts, it has been speculated that they are aggressive hunters. Other studies have suggested the contrary, describing them as voracious ambush predators.

Animal Foods: fish; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Apart from hosting one known parasitic species, no significant ecosystem roles have been suggested or documented in Anoplogaster cornuta. In a small sample of A. cornuta collected near the Grand Banks, southeast of Newfoundland, it was discovered that Tautochondria dolichoura parasitizes them. No other parasites have been reported. Although the nature of its interaction with fangtooths was not studied, T. dolichoura was characterized by synampomorphies that indicated relation to a family of gill parasitizing copepods of Eudactylinidae, Lernanthropidae, and Pseudocyenidae.

Commensal/Parasitic Species:

  • Ho, J. 1987. Tautochondria dolichoura n. g., n. sp., a Copepod Parasitic on the Bathypelagic Fish Anoplogaster cornuta (Valenciennes) in the Western North Atlantic. Systematic Parasitology, 9: 179.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Major predators of Anoplogaster cornuta include tuna (e.g., albacore), and marlin. Their dark brown to black color likely reduces predation risk at depths with little to no sunlight penetration.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

As with all fish, Anoplogaster cornuta has large lateral lines along each side of its body. Lateral lines are essential in detecting changes in temperature and are important in detecting prey movements. Although they have eyes, their usefulness in perceiving the local environment has not been documented. Sunlight does not penetrate to bathypelagic depths at which adults may be found, and they are not bioluminescent. Thus, it is unlikely that their eyes are of much necessity at greater depths.

Perception Channels: visual ; acoustic ; vibrations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Oviparous (Ref. 36624).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

Adult and juvenile fangtooths are so morphologically dissimilar that they were believed to be separate species in the 1800s. In addition to differences in their physical appearance, they also consume different prey. Juveniles begin to look like adults after reaching approximately 8 cm in length, and they typically grow to 17 cm in length, with a maximum recorded length of 18 cm, although other sources report a maximum length of 16 cm. Length at reproductive maturity has been reported to be approximately 13 cm. Individuals are found at different depths during different stages of their life cycle, with larvae occuring closer to the surface and adults occuring at depths of up to 5000 m. However, overlap of habitats with respect to depth does occur at various stages of maturity.

Anoplogaster cornuta is found at different depths during various stages of its life cycle and occupies a wide range of temperatures throughout its life. Juveniles may be captured at relatively shallow depths of 45 m in the tropics, where temperatures can rise above 15ºC. This suggests that while they are a stenothermal species with adults often captured at depths with temperatures between 4ºC and 6ºC, adults may be able for survival across a much broader thermal range.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The average lifespan of fangtooths has not been documented.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Very little is known about reproduction in deep-sea fish, but many pelagic fish, including Anoplogaster cornuta, are believed to share similar reproductive mechanisms. They generally reach reproductive maturity at 13 cm in length. In many species, males are typically smaller than females, and tend to be parasitic of females, firmly latching onto their mate’s body with their jaws. Fertilization subsequently occurs, and its efficacy is dependent upon the female’s circulatory system. It is not known where the species reproduces, but it is believed that it has no special spawning areas.

Fangtooths spawn from June to August. Little else is known of reproduction in this species. Ceratioid anglerfishes ensure that both sexes are together at spawning time, which might also be occur in fangtooths.

Breeding season: Fangtooths are thought to breed from June to August.

Key Reproductive Features: sexual ; oviparous

Fangtooths are oviparous and have planktonic larvae. There is no parental care. Larvae, juveniles, and adults live in completely different regions of the ocean and little overlap occurs between habitats.

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anoplogaster cornuta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACACGCTGATTTTTCTCAACCAACCACAAAGACATTGGCACCCTGTATCTCGTATTTGGTGCCTGAGCCGGCATGGTCGGCACAGCCCTAAGTTTGCTCATCCGTGCCGAACTTAGCCAACCCGGGGCACTCCTCGGGGACGACCAGATTTATAATGTTATTGTTACAGCACATGCCTTTGTAATAATTTTCTTTATAGTAATACCAGTTATAATCGGAGGCTTTGGGAACTGACTTGTTCCCCTAATGATCGGGGCCCCTGACATAGCATTTCCTCGAATAAATAATATGAGTTTCTGACTCCTTCCCCCCTCCTTCCTACTTCTGCTGTCCTCCTCCGGAGTTGAAGCAGGGGCCGGAACCGGGTGAACCGTCTACCCGCCCCTCGCAGGAAACCTTGCCCACGCAGGAGCTTCCGTAGACCTAACCATCTTCTCCCTTCACTTAGCAGGTATCTCCTCCATTCTAGGGGCCATTAACTTTATTACAACTATTATTAATATGAAACCCCCAGCCATCTCCCAATACCAAACCCCTTTATTTGTGTGGTCCGTTCTTATTACAGCAGTCCTCCTTCTCCTCTCCCTCCCCGTCCTTGCAGCCGGCATCACCATGCTTCTGACAGATCGTAACCTTAATACAACCTTCTTTGACCCCGCAGGAGGGGGTGACCCCATCCTGTACCAACACCTGTTCTGATTCTTTGGCCACCCCGAAGTCTACATTCTTATTCTCCCAGGGTTTGGTATAATCTCCCATATTGTCGCCTATTACTCTGGTAAAAAAGAACCCTTTGGTTATATGGGAATAGTCTGAGCCATAATGGCCATTGGCCTACTTGGCTTTATTGTCTGAGCCCATCACATGTTTACAGTCGGAATGGACGTAGACACACGGGCCTACTTTACTTCCGCCACCATGATTATTGCCATTCCAACAGGCGTAAAAGTGTTTAGCTGACTGGCTACGCTCCATGGGGGCTCCATTAAATGAGAAACCCCCCTCCTATGAGCACTCGGCTTTATCTTCCTCTTTACAGTGGGGGGCCTTACAGGGATCGTTCTGGCTAATTCCTCACTAGACATTGTTCTCCACGACACTTATTACGTAGTTGCCCACTTCCACTATGTCCTCTCCATGGGGGCTGTTTTCGCTATTATGGCCGCCTTCGTACACTGATTCCCCCTCTTCTCAGGCTATACTCTCCACAGTACATGAACGAAAATCCATTTCGGCGTTATATTCTTCGGGGTAAACCTTACATTCTTCCCGCAGCACTTCCTGGGGTTAGCAGGAATACCTCGTCGGTACTCAGATTACCCTGATGCCTACACCCTGTGAAACACCGTCTCCTCCATCGGCTCTTTAGTGTCATTACTCGCAGTAATCATGTTCTTATTTATTATTTGAGAAGCATTTGCTGCCAAACGAGAGGTCCTCTCAGTAGAACTAACCGCCACCAATGTAGAGTGACTACACGGCTGCCCTCCGCCTTACCACACATTTGAAGAGCCTGCATTCGTTCAAGTTCAGACAAATTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Anoplogaster cornuta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 33
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

The population trends of Anoplogaster cornuta have not been documented. Thus, the potential conservation and management needs of this species are unknown.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
  • Paxton, J.R. 1999 Order Beryciformes. Anoplogastridae. Fangtooths. p. 2210. In K.E. Carpenter and V.H. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the WCP. Vol. 4. Bony fishes part 2 (Mugilidae to Carangidae). FAO, Rome.   http://www.fishbase.org/references/FBRefSummary.php?id=9852 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse effects of Anoplogaster cornuta on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

There are no known positive effects of Anoplogaster cornuta on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Anoplogaster cornuta

Anoplogaster cornuta, the Common fangtooth, is a species of fangtooth found in temperate and tropical oceans worldwide. It is found at depths of from 2 to 4,992 metres (6.6 to 16,378 ft) with the adults usually found from 500 to 2,000 metres (1,600 to 6,600 ft) and the young usually found near the surface. This species grows to a length of 18 centimetres (7.1 in) TL. While a source of food for pelagic carnivorous fishes, this species is of no interest for human fisheries.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!