Alestes baremoze — Details

Silversides learn more about names for this taxon

Overview

Comprehensive Description

Biology

Learn more about this article

Mainly diurnal. There is considerable flexibility in its diet, A. baremoze shifts from zooplankton to zoobenthos, detritus and macrophytes as plankton densities decline (Ref. 28714). Occurs at a temperature range of 14.6-35.0°C. In the Malamfatori area (Tchad), seine-net fishery on the River Yobe depends on seasonal upstream (from Lake Chad) and downstream migration during the flood (August-December) and dry (January-March) seasons, respectively. Also, there is an intensive gillnet fishery from July-October at the river mouth. A. baremoze moves offshore (in Lake Chad) beginning March.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Distribution

Learn more about this article

Africa: Senegal, Gambia, the coastal basins of the Côte d'Ivoire (Comoé, Bandama and Sassandra), Volta, Niger, Chad basin, Nile, Lake Albert and Lake Turkana (Ref. 2880, 81279). Three subspecies can be distinguished: Alestes baremoze baremoze in Nile River, Lake Albert, Omo River and Lake Turkana; Alestes baremoze soudaniensis in Senegal River, Gambia River, Tominé River, Volta basin, Niger basin and Chad basin; Alestes baremoze eburneensis in coastal basins of Côte d'Ivoire, namely Sassandra River, Bandama River and Comoé River (Ref. 42019).
  • Paugy, D. 2003 Alestidae. p. 236-282. In D. Paugy, C. Lévêque and G.G Teugels (eds.) The fresh and brackish water fishes of West Africa Volume 1. Coll. faune et flore tropicales 40. Institut de recherche de développement, Paris, France, Muséum national d'histoire naturelle, Paris, France and Musée royal de l'Afrique Central, Tervuren, Belgium, 457p. (Ref. 81279)   http://www.fishbase.org/references/FBRefSummary.php?id=81279&speccode=2405 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Range Description

Learn more about this article

This species is mainly found in inshore zones of lakes, across a large range within Africa

Eastern Africa: It is found within Lake Albert, the Albert and Murchison Niles, and Lake Turkana.

Northern Africa: This fish used to be found along the whole of the River Nile in Egypt; in Delta lakes, Rashid Branch and Lower Nile, but is now restricted to the upper Nile after the High Dam construction, so is no longer found within this region.

Northeast Africa: This species is found in the Ghazal and Jebel systems; White and Blue Niles in Sudan, and the River Nile as far north as Lake Nasser (also known as Lake Nubia). It is also present in the Baro River, Ethiopia

Western Africa: Widespread in western Africa; Chad, Niger/Benue, Volta, Comoé, Bandama, Sassandra, Tominé, Gambia and Senegal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Physical Description

Morphology

Learn more about this article

Dorsal soft rays (total): 10; Analsoft rays: 22 - 31; Vertebrae: 41 - 49
  • Paugy, D. 2003 Alestidae. p. 236-282. In D. Paugy, C. Lévêque and G.G Teugels (eds.) The fresh and brackish water fishes of West Africa Volume 1. Coll. faune et flore tropicales 40. Institut de recherche de développement, Paris, France, Muséum national d'histoire naturelle, Paris, France and Musée royal de l'Afrique Central, Tervuren, Belgium, 457p. (Ref. 81279)   http://www.fishbase.org/references/FBRefSummary.php?id=81279&speccode=2405 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Size

Learn more about this article

Maximum size: 430 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Max. size

Learn more about this article

43.0 cm TL (male/unsexed; (Ref. 2703)); 40 cm TL (female); max. published weight: 500 g (Ref. 3023); max. reported age: 6 years (Ref. 2758)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Diagnostic Description

Learn more about this article

Diagnosis: This species has 38-51 lateral line scales, with 7.5-9.5 above and 3.5 below; anal fin with three simple rays and 19-28 branched rays; 30-41 gill rakers on lower limb of first gill arch; dorsal-fin origin distinctly behind level of pelvic-fin insertions (Ref. 81279).Description: External border of anal fin curves: slightly and regularly concave in females; forms an anterior lobe in males with some rays clearly longer; well developed fontanel (Ref. 2759).Colour: Silver colored with blue-gray back and white belly, grayish fins, entirely covered with scales; Sudanese fishes have orange colors on the inferior lobe of the caudal fin (Ref. 2759).
  • Paugy, D. 2003 Alestidae. p. 236-282. In D. Paugy, C. Lévêque and G.G Teugels (eds.) The fresh and brackish water fishes of West Africa Volume 1. Coll. faune et flore tropicales 40. Institut de recherche de développement, Paris, France, Muséum national d'histoire naturelle, Paris, France and Musée royal de l'Afrique Central, Tervuren, Belgium, 457p. (Ref. 81279)   http://www.fishbase.org/references/FBRefSummary.php?id=81279&speccode=2405 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Ecology

Habitat

Environment

Learn more about this article

benthopelagic; potamodromous (Ref. 51243); freshwater; pH range: 6.5 - 7.8; dH range: 30
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Habitat and Ecology

Learn more about this article

Habitat and Ecology
This diurnal species is mainly found in inshore zones of the lakes, but is also potamodromous and benthopelagic. It occurs at temperature range of 14.6oC to 35.0oC. It has a considerable flexibility in diet as it shifts from zooplankton to zoobenthos, detritus and macrophytes as plankton densities decline. Breeding fishes of both sexes are found in sheltered bays around the lakes shores; Adult fishes range between 30-45 cm long. Reservoir ecology with upriver migration from the reservoir of prereproductive adults between May and September, to meet and mature in the rising floods to the south.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Migration

Learn more about this article

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Trophic Strategy

Learn more about this article

Passive feeder, consume what is available. Daily zooplankton consumption 1.18-2.77% of body weight (Ref. 2875), 1.093 g zooplankton to reach 96 g growth in 2 years, 8.8% weight zooplankton absorbed, 11.4 g zooplankton to get 1 g fish, conversion efficiency of 44.8%. Feeding adaptation other than zooplanktivory, due to absence of food in non-flooded zones. Flooded zones provide cover and offer various food source. Young fish stay in dense shoals in small inlets along with Micralestes acutidens from October until early April (Ref. 3648).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Diseases and Parasites

Learn more about this article

Annulotrema Infestation 4. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Life History and Behavior

Life Cycle

Learn more about this article

Spawning cycle from Tables XVI-XVIII of Ref. 2759 for maturity stages 3-4 GSI 1.5-16% from deltaic zone, upstream (Logone-Chari River), downstream (N'Djamena) and in the southeastern archipelago of Lake Chad. Spawning takes place from 16:30-20:00 h. Eggs spawned in one batch representing 15% of weight of female. Mature females dispersed, not forming groups.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Alestes baremoze

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTTATCTTGTATTTGGTGCTTGAGCCGGAATGGTTGGGACTGCCCTTAGCCTATTAATTCGAGCAGAACTAAGTCAGCCCGGATCTCTCCTCGGGGACGACCAGATTTACAATGTTATCGTTACAGCACATGCATTTGTAATAATCTTTTTCATGGTCATACCAATTATAATTGGCGGCTTTGGGAATTGACTCGTACCCCTGATAATTGGTGCCCCCGATATAGCATTTCCACGAATAAATAATATGAGCTTCTGACTTCTTCCTCCATCTTTCCTTCTCCTCTTAGCCTCTTCAGGCGTGGAAGCAGGGGCCGGAACAGGCTGAACAGTTTATCCTCCCCTCGCTGGAAATCTTGCCCACGCAGGAGCATCCGTTGATTTAACTATTTTTTCACTACATCTTGCAGGTGTCTCTTCCATTCTTGGTGCAATTAACTTCATTACTACTATTGTAAACATAAAACCCCCTGCCATCTCACAGTACCAAACCCCCTTATTTGTTTGGGCTGTTTTAATTACAGCTGTCCTATTACTACTATCCCTTCCCGTTCTGGCCGCAGGCATTACTATACTACTAACGGACCGAAATTTAAACACTACCTTTTTTGACCCTGCCGGAGGAGGAGACCCAATTCTTTATCAACACTTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Statistics of barcoding coverage: Alestes baremoze

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Conservation

Conservation Status

IUCN Red List Assessment

Learn more about this article


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Akinyi, E., Awaïss, A., Azeroual, A., Getahun, A., Lalèyè, P. & Twongo, T.

Reviewer/s
Snoeks, J., Tweddle, D., Getahun, A., Lalèyè, P., Paugy, D., Zaiss, R., Fishar, M.R.A. & Brooks, E.

Contributor/s

Justification
This species has a wide distribution, with no known major widespread threats. It is therefore listed as Least Concern. It has also been assessed regionally as Least Concern for east, north, and west Africa. This species used to be found along the whole River Nile, including in Delta Lakes, Rashid branch and Lower Nile. It is now restricted to the upper Nile (outside the Northern Africa Region) due to the High Dam (Lake Nasser) construction, as is therefore listed as Regionally Extinct within the north Africa regional assessment.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Population

Learn more about this article

Population
Little information is available on the population of this species, although it is known to be common in Jebel Aulia and Roseires reservoirs, and in Lake Nasser (Bailey 1994).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Threats

Learn more about this article

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Major Threats
Regionally, this species faces different threats:

Eastern Africa: This species is currently overfished

Northern Africa: Within the region the construction of the Aswan High Dam seems to caused the regional extirpation of the species. Overfishing and water abstraction are also thought to have threatened the species.

Northeast Africa: Unknown

Western Africa: This species is locally threatened by pollution and agricultural development leading to habitat loss and degradation. In the Malamfatori area (Tchad), seine-net fishery on the River Yobe depends on seasonal upstream (from Lake Chad) and downstream migration during the flood (August-December) and dry (January-March) seasons, respectively. Also, there is an intensive gillnet fishery from July-October at the river mouth. A. baremoze moves offshore (in Lake Chad) beginning March.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Management

Conservation Actions

Learn more about this article

Conservation Actions
No information on conservation measures is available for this species, though the population trend should be monitored.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Relevance to Humans and Ecosystems

Benefits

Importance

Learn more about this article

fisheries: highly commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!