Overview

Comprehensive Description

Biology

Common in shallow reefs. Usually in pairs, often near sea fans (Ref. 9710). Feed on sponges, algae, bryozoans, zoantharians, gorgonians and tunicates (Ref. 9626). Oviparous (Ref. 240), monogamous (Ref. 52884). Spawning pairs are strongly territorial, with usually both members vigorously defending their areas against neighboring pairs (Ref. 38726). Juveniles tend cleaning stations where they service a broad range of clients, including jacks, snappers, morays, grunts, surgeonfishes, and wrasses. At the station the cleaner displays a fluttering swimming and when cleaning it touches the clients with its pelvic fins (Ref. 40094). Flesh considered good quality; marketed fresh (Ref. 3797). Has been reared in captivity (Ref. 35419).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: Florida, USA and Bahamas to Brazil, including the Gulf of Mexico and the Caribbean (Ref. 26938). Eastern Atlantic: off Ascension Island (Ref. 7379) and St. Paul's Rocks (Ref. 13121).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is found from Florida and the Bahamas to Brazil and straggling north to New York in the Gulf Stream. Has been introduced to Bermuda but not established, however, rare waifs reported from Bermuda. Also reported from St. Helena and Ascenscion Islands in the eastern Atlantic (Burgess 2002). It has been reported as vagrants from West Africa (Allen 1980). Present at depths of 3-100 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Pomacanthus paru are abundant along coral reefs along both sides of the Atlantic. The distribution in the Western Tropical Atlantic ranges from Florida and the Bahamas to Brazil. In the Eastern Atlantic, they are found in West Africa and Cape Verde Island. It also has recently been introduced to Bermuda (Allen 1985, Eli 2000).

Biogeographic Regions: atlantic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic and St. Paul's Rocks and islands in the eastern Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10; Dorsal soft rays (total): 29 - 31; Analspines: 3; Analsoft rays: 22 - 24
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size: Adults can reach a maximum length of 41.1 cm.

Coloration: The appearance of P. paru differs greatly between juveniles and adults. Young P. paru are a dark brown to black color with thick, curved yellow bands across the head and body. As an adult, the yellow bands fade except for one yellow bar at the outer base of the pectoral fin. The scales turn black with yellow rims and the face becomes light blue with a white chin and mouth region.

Body shape: The disc-shaped Angelfish family is distinguished by a strong, curved, projecting spine on the lower edge of the preopercle bone and the absence of a pelvic axillary process. On juveniles, the spine is serrate and smoothes out in the adult form. The stout spine found on the gill cover gives P. paru its name (Pom= "cover", acanthus= "spine"), and distinguishes them from the closely related butterflyfishes (Allen 1985, Helfman 1997, Nelson 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 411 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

41.1 cm TL (male/unsexed; (Ref. 9626))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Black, the scales of the body , except those at front from nape to abdomen, rimmed with golden yellow; a broad orange-yellow bar at pectoral absent; dorsal filament yellow; chin whitish; outer part of iris yellow; eye narrowly rimmed below with blue (Ref. 13442)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 3 - 100 m (Ref. 7379)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is common in shallow rocky and coral reefs. It is usually found in pairs, often near sea fans. The species feeds on sponges, algae, bryozoans, zoantharians, gorgonians and tunicates. Spawning pairs are strongly territorial, with usually both members vigorously defending their areas against neighbouring pairs. Juveniles tend cleaning stations where they service a broad range of clients, including jacks, snappers, morays, grunts, surgeonfishes and wrasses.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

They are found in coral reef areas in depths of less than forty meters. At night, P. paru seek cover, usually returning to the same place every night. They are often associated with rocky, broken bottoms, coral reefs, and grassy flats, which provide sufficient hiding places and enough coverage.

Physically, P. paru does well under a broad range of conditions. They are eurayhaline, meaning they tolerate a wide span of salinity. Temperatures in the mid seventy degrees are optimal for this species (Allen 1985,   http://www.hood.edu/academic/biology/frenchangelfish.htm).

Aquatic Biomes: reef

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 401 specimens in 1 taxon.
Water temperature and chemistry ranges based on 280 samples.

Environmental ranges
  Depth range (m): 0.4 - 127
  Temperature range (°C): 19.645 - 28.503
  Nitrate (umol/L): 0.125 - 7.308
  Salinity (PPS): 34.217 - 37.169
  Oxygen (ml/l): 3.728 - 4.773
  Phosphate (umol/l): 0.046 - 0.633
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 0.4 - 127

Temperature range (°C): 19.645 - 28.503

Nitrate (umol/L): 0.125 - 7.308

Salinity (PPS): 34.217 - 37.169

Oxygen (ml/l): 3.728 - 4.773

Phosphate (umol/l): 0.046 - 0.633

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 3 - 100m.
From 3 to 100 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Common in shallow reefs. Usually in pairs, often near sea fans (Ref. 9710). Feed on sponges, algae, bryozoans, zoantharians, gorgonians and tunicates (Ref. 9626). Browser fish (Ref. 33499).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

P. paru are mostly omnivorous. Juveniles feed on a mix of algae and detritus with occasional parasites, acquired from other fish. The diet of adults is made up mostly of sponges. They also consume tunicates, gorgonians, hydroids, zoantharians and coral as alternative sources of food (Allen 1985, Eli 2000).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

This species manifests apparent permanent pairing and monogamy. During most of the observation period, a single pair swam slowly in a side-to-side orientation at a height of 25 to 75 cm above the reef. No conspicuous courtship displays were evident, nor was there any evidence of sexual identity, i.e., the female was not obviously swollen with eggs. Shortly after sunset, the pair ascended in a broad, shallow arc off the bottom, traversing approximately 7 to 10 m while ascending to a height of 2 to 3 m. As the pair ascended, each angled its body slightly, with their venters in close proximity, if not actually touching. This position was held throughout the peak of the arc, with the pair diverging on the descent. Other pairs in the area were seen making similar arcing movements elsewhere on the reef at approximately the same time. It was difficult to see if there were gametes released in the event. There was no interference between pairs during spawning.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Maturity is reached at an age of 3.4 years. Reproduction is a pair-spawning, egg-scattering process. The egg-filled female travels with the male to the surface where both the eggs and sperm are released into the water. The eggs develop in beds of floating plankton where the young grow until they can travel down to the coral reef (Allen 1985,   http://www.hood.edu/academic/biology/frenchangelfish.htm).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pomacanthus paru

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTACTATTTGGTGCTTGAGCCGGRATGGTAGGCACTGCTTTGAGCCTACTAATTCGAGCCGAGCTAAATCAACCGGGCAGCCTTCTCGGAGACGACCAGATCTACAATGTTATCGTTACAGCACACGCATTCGTAATAATTTTTTTTATGGTGATGCCCGCCATGATCGGAGGCTTTGGAAATTGATTAGTCCCACTAATAATTGGAGCCCCAGACATAGCATTTCCTCGAATAAATAATATAAGCTTTTGACTCCTGCCCCCTTCTCTTCTTCTTCTCCTTGCTTCCGCCGGGGTAGAGGCCGGAGCTGGAACTGGATGGACAGTTTACCCGCCCCTAGCTGGCAATCTAGCCCACGCAGGAGCATCCGTAGACCTGACCATCTTCTCCCTCCACCTGGCCGGAATCTCCTCAATTCTAGGGGCTATTAACTTTATCACAACCATTATTAACATAAAACCCCCTGCTATTTCACAATACCAAACTCCACTATTTGTGTGAGCTGTCCTAATTACTGCAGTGCTACTTCTGCTTTCTCTCCCCGTCCTTGCTGCCGGCATCACAATGCTTCTTACAGACCGAAATCTTAATACTACTTTCTTTGACCCTGCAGGAGGGGGAGACCCAATTCTTTACCAGCACTTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pomacanthus paru

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Pyle, R., Myers, R., Rocha, L.A. & Craig, M.T.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification
While this species is common in the aquarium trade, no significant declines were detected in its numbers except within a few local populations in northeastern Brazil. Listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Relatively common throughout its range with stable populations.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats

The only threat is collection for the aquarium trade, however, present harvest levels do not seem to be impacting the global population.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

This species is present within many marine protected areas. A maximum export quota of 5,000 specimens from Brazil has been established for this species, which exceeds the current collection levels.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

none known

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

P. paru has economic importance in the commercial aquarium trade and is collected by means of non-damaging nets. They are sold for a minimum of fifty-six dollars in the aquarium trade. The high tolerance to physical changes, disease-resistance, and longevity establishes this species as an ideal aquarium specimen. This hardiness enables aquarium owners to enjoy the beauty and elegance of this fish in their homes

There is minor commercial fishery use of P. paru. Their flesh has been marketed and is used for human consumption in Singapore and Thailand (Eli 2000,   http://www.wetwebmedia.com/FrAng.htm).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

French angelfish

The French Angelfish, Pomacanthus paru, is a large angelfish of the family Pomacanthidae, found in the western Atlantic from Florida and the Bahamas to Brazil, and also the Gulf of Mexico and the Caribbean, including the Antilles, and the eastern Atlantic from around Ascension Island and St. Paul's Rocks, at depths of between 2 and 100 m. Length is up to 41 cm.

Author: William Eburn Place: Grand Cayman

The French angelfish is common in shallow reefs, occurs usually in pairs often near sea fans. It feeds on sponges, algae, bryozoans, zoantharians, gorgonians and tunicates. Juveniles tend cleaning stations where they service a broad range of clients, including jacks, snappers, morays, grunts, surgeonfishes, and wrasses. At the station the cleaner displays a fluttering swimming and when cleaning it touches the clients with its pelvic fins.

The adult background coloration is black but the scales of the body, except those at the front from nape to abdomen, are rimmed with golden yellow. Furthermore the pectoral fins have a broad orange-yellow bar, the dorsal filament is yellow, the chin is whitish, the outer part of the iris is yellow, and the eye is narrowly rimmed below with blue. Juveniles are black with vertical yellow bands.

This species is oviparous and monogamous. Spawning pairs are strongly territorial and usually both partners defend vigorously their territory against neighboring pairs.

The flesh of the French angel has good taste and the fish is sold on fish markets. The species has been reared in captivity.

Sponges constitute 70% of the species' diet and since sponges are plentiful the fish is normally well fed. It covers sponge pieces in thick mucous to help digestion.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!