Overview

Comprehensive Description

Biology

Common in coral reefs, usually solitary, occasionally in pairs. Juveniles are part-time cleaners. Feed mainly on sponges, but also takes tunicates, algae, zoantharians, gorgonians, hydroids, bryozoans, and seagrasses. Oviparous (Ref. 240), monogamous (Ref. 52884). Flesh reported to be of excellent quality (Ref. 3797); marketed fresh and salted (Ref. 5217). Friendly toward divers (Ref. 9710). Have been reared in captivity (Ref. 35419).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: from New England, USA to the vicinity of Rio de Janeiro, Brazil. Also Bahamas, Gulf of Mexico, and Caribbean, including Antilles
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is distributed in the western Atlantic from New York (probably not overwintering north of Florida) (USA), throughout the Caribbean and the Gulf of Mexico, to Rio de Janeiro (Brazil) (Burgess 2002). Reported by Burgess (2002) to have been introduced to Bermuda. It is found at depths of 2-30 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: New England, USA to the vicinity of Rio de Janeiro, Brazil, including the Gulf of Mexico and the Caribbean (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 31 - 33; Analspines: 3; Analsoft rays: 23 - 25
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 600 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

60.0 cm TL (male/unsexed; (Ref. 3797)); max. published weight: 1,830 g (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Pale gray around mouth, and pale gray margin on caudal fin. Inside of pectoral fin yellow (Ref. 26938). Juveniles are black with two light yellow bars on body and three on head; caudal fin yellow with a vertically elongate, nearly rectangular or hemispherical black spot in middle (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Fairly common on coral and rocky reefs. Seen mostly in pairs, but also as individuals and in small groups. They feed on various invertebrates (mostly sponges) and algae (Burgess 2002).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 2 - 30 m (Ref. 9626)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 475 specimens in 1 taxon.
Water temperature and chemistry ranges based on 296 samples.

Environmental ranges
  Depth range (m): 0.5 - 97
  Temperature range (°C): 21.955 - 28.067
  Nitrate (umol/L): 0.115 - 3.505
  Salinity (PPS): 34.217 - 37.169
  Oxygen (ml/l): 4.285 - 4.992
  Phosphate (umol/l): 0.046 - 0.380
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 0.5 - 97

Temperature range (°C): 21.955 - 28.067

Nitrate (umol/L): 0.115 - 3.505

Salinity (PPS): 34.217 - 37.169

Oxygen (ml/l): 4.285 - 4.992

Phosphate (umol/l): 0.046 - 0.380

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 2 - 30m.
From 2 to 30 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Common in coral reefs. Feed mainly on sponges, but also takes tunicates, algae, zoantharians, gorgonians, hydroids, bryozoans, and seagrasses. Omnivore (Ref. 57616).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pomacanthus arcuatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTACTATTTGGTGCTTGAGCCGGAATGGTAGGCACTGCTTTAAGCCTACTAATTCGAGCCGAGCTAAATCAACCGGGCAGCCTTCTCGGAGACGACCAGATCTACAATGTTATCGTTACAGCACACGCATTCGTAATAATTTTTTTTATGGTAATGCCCGCCATAATCGGAGGCTTTGGAAATTGATTAGTCCCACTAATAATTGGAGCCCCAGACATAGCATTTCCTCGAATAAATAATATAAGCTTTTGACTCCTGCCCCCTTCTCTTCTTCTTCTCCTTGCTTCCGCCGGGGTAGAAGCCGGAGCTGGAACTGGATGAACAGTTTACCCGCCTCTAGCTGGCAATCTAGCCCACGCAGGAGCATCCGTAGACCTAACCATCTTCTCCCTCCACCTAGCCGGAATCTCCTCAATTCTTGGGGCCATTAACTTCATCACAACCATCATTAACATAAAACCCCCTGCTATTTCACAATACCAAACTCCCCTATTTGTGTGAGCCGTCCTAATTACTGCAGTACTACTTCTGCTTTCCCTCCCCGTCCTTGCTGCCGGCATCACAATGCTTCTCACAGACCGAAATCTTAACACTACTTTCTTTGACCCTGCAGGAGGGGGAGATCCAATTCTTTACCAGCACTTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pomacanthus arcuatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Pyle, R., Myers, R., Rocha, L.A. & Craig, M.T.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification

Listed as Least Concern in view of its wide distribution, large population and no apparent major threats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This is a relatively common species with stable populations.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats

Collection for the aquarium trade is a local threat, but it does not seem to be affecting the population globally.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

There appear to be no species-specific conservation measures in place. This species is present within a number of marine protected areas. A maximum quota of 3,000 specimens for export from Brazil has been established for this species, which exceeds the current collection levels.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Gray angelfish

The gray angelfish or gray angelfish (Pomacanthus arcuatus) is a large angelfish of the family Pomacanthidae, found in the western Atlantic from New England to the vicinity of Rio de Janeiro, Brazil, and also the Bahamas, the Gulf of Mexico, and the Caribbean, including the Antilles, at depths of between 2 and 30 m. Length is up to 60 cm. It weighs about 2.0 kg. It feeds mainly on sponges, it is usually found in warm water, in coral reefs, and in oceans.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!