Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Coal fish (also called saithe) are feared predators. Not only do they eat small crustaceans, herring and sprat, they even eat their own young. They closely resemble whiting. The greatest difference is found in the jaw. While by coal fish the lower jaw sticks out, it's the upper jaw that sticks out by whiting. Coal fish often live in large schools on or just above the sea floor. On a global scale, this fish is number two on the list of most important species for the fisheries. Only anchovies (from the Atlantic and Pacific Oceans together) are caught more often.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

An active, gregarious fish occurring inshore and offshore waters. Usually enters coastal waters in spring and returns to deeper waters in winter (Ref. 9988). Smaller fish in inshore waters feed on small crustaceans (copepods, amphipods, euphausiids) and small fish, while larger fish prey predominantly upon fishes. Spawn in batches (Ref. 51846). Utilized fresh, dried or salted, smoked, canned and frozen; eaten steamed, fried, broiled, boiled, microwaved and baked (Ref. 9988).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

 The saithe or coalfish Pollachius virens is a member of the pollack family. It can reach 1.2 m in length. It has three dorsal and two anal fins. It has a straight lateral line, which is light in colour. The back and sides are usually dusky greenish-brown in colour and the belly is silvery white. The upper and lower jaws are approximately equal in length.Saithe is a highly valued commercial species for human consumption. To maintain sustainable saithe fisheries and create a greater potential yield, the EU and Norway have agreed on a precautionary approach. The stock is now managed by annual TACs (total allowable catch) and a minimum mesh size for several types of fishing gear limits the bycatch of smaller individuals. Unlike the pollack Pollachius pollachius, it has a straight lateral line, which is light in colour.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The coalfish has a typical cod family shaped body with three dorsal and two anal fins. The first anal fin originates beneath the space between the first and second dorsal fins. The upper and lower jaws are approximately equal in length and there is no chin barbel. The lateral line is straight and light in colour. The back and sides are dusky greenish-brown or blackish and the belly is silvery white. The pale lateral line is conspicuous against the dusky sides. Most adult fish are between 70-80cm in length although it can grow to 1.3m. See comments on the pollack (Pollachius pollachius).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Pollachius virens occurs on both sides of the North Atlantic. In the western Atlantic, their distribution is centered between Cape Cod and the Strait of Canso, while in the eastern Atlantic they are mainly found around Iceland, in the North Sea, and off the northern coast of Norway (Steele 1963). Specimens have been found as far south as North Carolina (Coles 1926), although their abundance is very low at the southern edge of their range. They are native to much of the Atlantic and Arctic Oceans.

Biogeographic Regions: arctic ocean (Native ); atlantic ocean (Native )

  • Coles, R. 1926. Notes on Cape Lookout (North Carolina) fishes - 1925.. Copeia, 151: 105-106.
  • Steele, D. 1963. Pollock (Pollachius virens (L.)) in the Bay of Fundy. J. Fish. Res. Board Can., 20: 1267-1314.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

southwest Greenland, Hudson Strait to North Carolina, although rare at the extremes of the range
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Atlantic (including Baltic Sea, North Sea).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Atlantic: Barents Sea, Spitsbergen to Bay of Biscay, around Iceland. Western Atlantic: southwest Greenland, Hudson Strait to North Carolina, although rare at the extremes of the range. Migrations for spawning are known to occur. Also long-distance north-south migrations for Europe and the US.
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Continental waters on both sides of the North Atlantic. Southeastern Gulf of St. Lawrence and northeastern Nova Scotia to New Jersey; southward occasionally to Chesapeake Bay and to Cape Lookout, N. C. Southern part of the Grand Banks, to the southern coast of Newfoundland, and to Sandwich Bay on the southeastern coast of Atlantic. Labrador, West Greenland, Spitzbergen, Iceland, and the coasts of northwestern Europe south to the North Sea, English Channel, and Brittany coast of the Bay of Biscay in the eastern Atlantic.
  • Bigelow, H. B. and Schroeder,W.C., 1953; Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba, 1990; Frimodt, C., 1995.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species is common and widespread all around the coasts of Britain and Ireland.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Pollock are brownish-green dorsally with the color becoming more pale ventrally. They have a pale, smooth lateral line that is interrupted. The body is fusiform. They have a small chin barbel and a terminal mouth (Cohen et al. 1990). Although there is evidence that some populations may be geographically isolated, there is no evidence that there are any important genetic differences between populations (Mayo et al. 1989). Adult pollock can reach maximum lengths of 130 cm but are usually less than 110 cm (Collette and Klein-MacPhee 2002). Mayo et al. (1989) reported that for the period 1970 to 1984 mean length was 50.5 cm for males and 47.9 cm for females. O'Brien et al. (1993) reported that for the period 1986 to 1988 mean length was 41.8 cm for males and 39.1 cm for females. This change in size has also been accompanied by a decrease in mean age at maturity (see Development).

Range mass: 32 (high) kg.

Average mass: 0.5-5 kg.

Range length: 28 to 130 cm.

Average length: 45-85 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: male larger

  • O'Brien, L., J. Burnett, R. Mayo. 1993. Maturation of nineteen species of finfish off the Northeast coast of the United States, 1985-1990.. NOAA Tech. Tep. NMFS, 113: 66 pp..
  • Collette, B., G. Klein-MacPhee. 2002. Pollock, Pollachius virens . Pp. xxxx in B Collette, G Klein-MacPhee, eds. Bigelow and Schroeder's fishes of the Gulf of Maine. Washington, D.C.: Smithsonian Institution Press.
  • Mayo, R., J. McGlade, S. Clark. 1989. Patterns of exploitation and biological status of pollock (Pollachius virens (L.)) in the Scotian Shelf, Georges Bank, and Gulf of Maine area. J. Northwest Atl. Fish. Sci., 9: 13-36.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 0; Analspines: 0
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

130 cm TL (male/unsexed; (Ref. 1371)); max. published weight: 32.0 kg (Ref. 7251); max. reported age: 25 years (Ref. 1371)
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

to 130 cm TL (male/unsexed); max. weight: 32 kg.
  • Bigelow, H. B. and Schroeder,W.C., 1953; Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba, 1990; Frimodt, C., 1995.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Chin barbel small. Lateral line smooth along its entire length. Body color is brownish-green dorsally, becoming only slightly paler ventrally. The lateral line pale.
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

The eggs are pelagic, and are typically found at depths of 50 to 90 m. Juvenile pollock move into the shallow littoral zone for the first two years of life (Steele 1963). Juvenile pollock often use macroalgae in the rocky intertidal zone as a source of refuge and forage during this period (Rangeley and Kramer 1995). Adults leave the shallow littoral zones and swim in large schools throughout the water column. Adults show no substrate preference, but temperature is an important factor. Adults may be found at depths ranging from 5 to 325 m, but more typically between 35 and 130 m (Cargnelli et al. 1999)

Range depth: 5 to 325 m.

Average depth: 35-130 m.

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: pelagic ; coastal

Other Habitat Features: intertidal or littoral

  • Rangeley, R., D. Kramer. 1998. Density-dependent antipredator tactics and habitat selection in juvenile Pollock. Ecology, 79: 943-952.
  • Cargnelli, L., S. Griesbach, D. Packer, P. Berrien, D. Johnson, W. Morse. 1999. Pollock, Pollachius virens, life history and habitat characteristics. NOAA Technical Memorandum, NMFS-NE-131: 1-30.
  • Rangeley, R., D. Kramer. 1995. Use of rocky intertidal habitats by juvenile pollock Pollachius virens . Mar. Ecol. Prog. Ser., 126: 9-17.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabit coastal waters in spring, move to deeper waters in winter.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 200m.
Recorded at 200 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; oceanodromous (Ref. 51243); marine; depth range 37 - 364 m (Ref. 5951)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
  • Scott, W.B. and M.G. Scott 1988 Atlantic fishes of Canada. Can. Bull. Fish. Aquat. Sci. 219:731 p. (Ref. 5951)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 61922 specimens in 1 taxon.
Water temperature and chemistry ranges based on 51924 samples.

Environmental ranges
  Depth range (m): -9 - 675
  Temperature range (°C): -0.774 - 16.550
  Nitrate (umol/L): 1.186 - 22.184
  Salinity (PPS): 30.162 - 35.873
  Oxygen (ml/l): 3.118 - 7.862
  Phosphate (umol/l): 0.249 - 1.806
  Silicate (umol/l): 1.455 - 19.024

Graphical representation

Depth range (m): -9 - 675

Temperature range (°C): -0.774 - 16.550

Nitrate (umol/L): 1.186 - 22.184

Salinity (PPS): 30.162 - 35.873

Oxygen (ml/l): 3.118 - 7.862

Phosphate (umol/l): 0.249 - 1.806

Silicate (umol/l): 1.455 - 19.024
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 The saithe is a benthopelagic species; an active, gregarious fish occurring both inshore and offshore. It usually enters coastal waters in spring and returns to deeper waters (up to 350 m) in winter
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Demersal; marine; depth to 200 m. Gregarious. Inshore and offshore. Coastal waters in spring, returning to deeper waters in winter.
  • Bigelow, H. B. and Schroeder,W.C., 1953; Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba, 1990; Frimodt, C., 1995.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The coalfish is usually encountered in rocky areas or near wreck from the surface down to 250m depth. Juvenile fish are sometimes found in rockpools on the low shore. Young fish feed on crustaceans and small fish whilst adults feed on smaller members of the cod and herring family.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Stellwagen Bank Pelagic Community

 

The species associated with this page are major players in the pelagic ecosystem of the Stellwagen Bank National Marine Sanctuary. Stellwagen Bank is an undersea gravel and sand deposit stretching between Cape Cod and Cape Ann off the coast of Massachussets. Protected since 1993 as the region’s first National Marine Sanctuary, the bank is known primarily for whale-watching and commercial fishing of cod, lobster, hake, and other species (Eldredge 1993). 

Massachusetts Bay, and Stellwagen Bank in particular, show a marked concentration of biodiversity in comparison to the broader coastal North Atlantic. This diversity is supported from the bottom of the food chain. The pattern of currents and bathymetry in the area support high levels of phytoplankton productivity, which in turn support dense populations of schooling fish such as sand lance, herring, and mackerel, all important prey for larger fish, mammals, and seabirds (NOAA 2010). Sightings of many species of whales and seabirds are best predicted by spatial and temporal distribution of prey species (Jiang et al 2007; NOAA 2010), providing support for the theory that the region’s diversity is productivity-driven.

Stellwagen Bank is utilized as a significant migration stopover point for many species of shorebird. Summer visitors include Wilson’s storm-petrel, shearwaters, Arctic terns, and red phalaropes, while winter visitors include black-legged kittiwakes, great cormorants, Atlantic puffins, and razorbills. Various cormorants and gulls, the common murre, and the common eider all form significant breeding colonies in the sanctuary as well (NOAA 2010). The community of locally-breeding birds in particular is adversely affected by human activity. As land use along the shore changes and fishing activity increases, the prevalence of garbage and detritus favors gulls, especially herring and black-backed gulls. As gull survivorship increases, gulls begin to dominate competition for nesting sites, to the detriment of other species (NOAA 2010). 

In addition to various other cetaceans and pinnipeds, the world’s only remaining population of North Atlantic right whales summers in the Stellwagen Bank sanctuary. Right whales and other baleen whales feed on the abundant copepods and phytoplankton of the region, while toothed whales, pinnipeds, and belugas feed on fish and cephalopods (NOAA 2010). The greatest direct threats to cetaceans in the sanctuary are entanglement with fishing gear and death by vessel strikes (NOAA 2010), but a growing body of evidence suggests that noise pollution harms marine mammals by masking their acoustic communication and damaging their hearing (Clark et al 2009).

General threats to the ecosystem as a whole include overfishing and environmental contaminants. Fishing pressure in the Gulf of Maine area has three negative effects. First and most obviously, it reduces the abundance of fish species, harming both the fish and all organisms dependent on the fish as food sources. Secondly, human preference for large fish disproportionately damages the resilience of fish populations, as large females produce more abundant, higher quality eggs than small females. Third, by preferentially catching large fish, humans have exerted an intense selective pressure on food fish species for smaller body size. This extreme selective pressure has caused a selective sweep, diminishing the variation in gene pools of many commercial fisheries (NOAA 2010). While the waters of the SBNMS are significantly cleaner than Massachusetts Bay as a whole, elevated levels of PCBs have been measured in cetaceans and seabird eggs (NOAA 2010). Additionally, iron and copper leaching from the contaminated sediments of Boston Harbor occasionally reach the preserve (Li et al 2010). 


  • Clark CW, Ellison WT, Southall BL, Hatch L, Van Parijs SM, Frankel A, Ponirakis D. 2009. Acoustic masking in marine ecosystems: intuitions, analysis and implication. Inter-Research Marine Ecology Progress Series 395:201-222.
  • Eldredge, Maureen. 1993. Stellwagen Bank: New England’s first sanctuary. Oceanus 36:72.
  • Jiang M, Brown MW, Turner JT, Kenney RD, Mayo CA, Zhang Z, Zhou M. Springtime transport and retention of Calanus finmarchicus in Massachusetts and Cape Cod Bays, USA, and implications for right whale foraging. Marine Ecology 349:183-197.
  • Li L, Pala F, Mingshun J, Krahforst C, Wallace G. 2010. Three-dimensional modeling of Cu and Pb distributions in Boston Harbor, Massachusetts and Cape Cod Bays. Estuarine Coastal & Shelf Science. 88:450-463.
  • National Oceanographic & Atmospheric Administration. 2010. Stellwagen Bank National Marine Sanctary Final Management Plan and Environmental Assessment. “Section IV: Resource States” pp. 51-143. http://stellwagen.noaa.gov/management/fmp/pdfs/sbnms_fmp2010_lo.pdf
Creative Commons Attribution 3.0 (CC BY 3.0)

© Peter Everill

Supplier: Peter Everill

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food sources differ between life history stages. Larval pollock subsist initially on yolk contained in egg sacks. Small larvae consume larval copepods, while larger larvae consume adult copepods (Steele 1963). Juvenile pollock subsist mainly on crustaceans, particularly the euphausiid Meganyctiphanes norvegica (Collette and Klein-MacPhee 2002), and to a lesser degree on fish and mollusks. Adults feed on crustaceans, fish, and mollusks as well, but the relative importance of these varies with the size of individual. The smallest adults (41 to 65 cm) feed primarily on crustaceans, medium size adults (66 to 95 cm) feed mainly on fish such as Atlantic herring Clupea pallasii pallasii, while the largest adults (> 95 cm) feed on mollusks such as squid Loligo (Bowman and Michaels 1984).

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods, Molluscivore )

  • Bowman, R., W. Michaels. 1984. Food of seventeen species of northwest Atlantic fish. NOAA Tech. Mem., NMFS-F/NEC-28: 183 p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Studies on the diet of this species in various localities in the North Atlantic have shown the pelagic character of its food. During its first two years of existence, it inhabits mostly coastal waters where it feeds mainly on plankton like appendicularians and crustaceans. After this coastal period, it migrates to the open sea and its food remains pelagic, although prey is larger and consists of euphausiids, fishes and cephalopods (Ref. 42118). Parasites of the species include 6 trematodes, 2 nematodes, 2 cestodes and 1 acanthocephalan; Hemiuris levinseni (trematode) being the most common, followed by Echinorhynchus gadi (Ref. 5951). See also Ref. 8999.
  • Pauly, D. 1989 Food consumption by tropical and temperate fish populations: some generalizations. J. Fish Biol. 35(Suppl. A):11-20. (Ref. 4587)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Small crustaceans (copepods, amphipods, euphausiids) and other fishes.
  • Bigelow, H. B. and Schroeder,W.C., 1953; Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba, 1990; Frimodt, C., 1995.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Pollock are an important predator in many ecosystems due to their population size and density. They play in important role in population dynamics for some crustaceans, fish, and mollusks (see 'Food Habits'). Sea lampreys Petromyzon marinus parasitize pollock.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major predators include seals, sea lions, whales, dolphins, and other large bony fish. Human fishing operations play a significant role in pollock mortality, and there is speculation that overfishing may be causing the decrease in age at maturity observed by Cargnelli et al. (1999). Adults and juveniles exhibit schooling as an anti-predator defense. Rangeley and Kramer (1998) found that schooling and habitat selection are important anti-predator strategies in juveniles; juveniles spend more time in algae beds in the presence of a predator. Juveniles that remain in the open were more likely to aggregate in the presence of a predator.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Pollachius virens (Pollachius virens saithe) is prey of:
Phalacrocorax carbo
Ardea cinerea
Hemiuris communis
Lecithaster gibbosus
Hysterothylacium aduncum

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Pollachius virens (Pollachius virens saithe) preys on:
Pomatoschistus microps
Crangon crangon
Nereis diversicolor
Ostracoda
Copepoda
Balanus balanoides
Neomysis integer
Corophium volutator
Gammarus

Based on studies in:
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Pollock rely on their lateral line system for schooling. Pitcher et al. (1976) covered the eyes of schooling ollock with opaque patches to demonstrate that vision is not necessary for schooling behavior. However pollock are not able to school if their lateral line has been severed, evidence that it is important for schooling. Pollock may use vision for prey detection and capture and for mating.

Perception Channels: visual ; tactile ; chemical

  • Pitcher, T., B. Partridge, C. Wardle. 1976. A Blind Fish Can School. Science, 194: 963-965.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diet

Feeds on copepods, amphipods and euphausiids
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Pollock are characterized by a pelagic larval stage that typically lasts between three and four months. When individuals reach 3 cm in length they migrate into the shallow sublittoral zone until near the end of their second year. Individuals are often termed "harbor" pollock at this stage (Steele 1963). At the end of their second year, juveniles move to offshore regions where they will spend most of their adult life (Cargnelli et al. 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Maximum reported age in pollock is 25 years. A more typical lifespan is 10 years. The majority of fish caught, however, range between 3 and 6 years of age (Mayo 1994).

Range lifespan

Status: wild:
25 (high) years.

Typical lifespan

Status: wild:
10 (high) years.

Average lifespan

Status: captivity:
25 years.

  • Mayo, R. 1994. Life histories and habitat requirements of demersal fishes. Pp. 2-3 in R Langton, J Pearce, J Gibson, eds. Selected living resources, habitat conditions, and human perturbations in the Gulf of Maine: Environmental and ecological considerations for fishery management.. Tech. Mem. NMFS-NE-106: NOAA.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Pollock undertake migrations to reach spawning grounds. The largest concentrations of spawning adults occur in Massachusetts Bay, the Stellwagen Bank, Cape Ann to the Isle of Shoals, the western Gulf of Maine and on the Scotian Shelf (Cargnelli et al. 1999). However, there is little information on the actual spawning event, and no knowledge of mating system (Cargnelli et al. 1999).

Pollock undertake north-south migrations for spawning. Spawning occurs between September and April but peaks between December and February (Cargnelli et al. 1999) . There is more variability in spawning time in northern sites than in southern sites. Spawning occurs over hard bottoms with stony or rocky surfaces, and is highly dependent on temperature. Spawning begins when water temperatures fall below 8 C, and peaks when temperatures are below 4.5 to 6 C. Spawning is reported to occur at salinities of 32 to 32.8 ppt (Collette and Klein-MacPhee 2002). Fecundity per female ranges from 200,000 to 8,260,000 eggs. Incubation time of eggs ranges from 5 to 15 days, and optimal development occurs at 8.9 C (Cargnelli et al. 1999).

Mayo et al. (1989) reported that for the period 1970 to 1984 mean age at maturity was 3.5 years for males and 3.2 years for females. O'Brien et al. (1993) reported that for the period 1986 to 1988 mean age at maturity had dropped to 2.3 years for males and 2.0 years for females.

Breeding interval: Pollock breed once yearly after reaching sexual maturity.

Breeding season: Spawning occurs between September and April, and is concentrated between December and February.

Range number of offspring: 200,000 to 8,260,000.

Range gestation period: 5 to 15 days.

Average age at sexual or reproductive maturity (female): 2.0 years.

Average age at sexual or reproductive maturity (male): 2.3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Average age at sexual or reproductive maturity (male)

Sex: male:
839 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Parents provide no care for the young, and eggs rise in the water column and drift after fertilization. Young have a yolk sack that is absorbed after approximately five days. The rate at which yolk is absorbed is temperature dependent (Steele 1963).

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female)

  • O'Brien, L., J. Burnett, R. Mayo. 1993. Maturation of nineteen species of finfish off the Northeast coast of the United States, 1985-1990.. NOAA Tech. Tep. NMFS, 113: 66 pp..
  • Cargnelli, L., S. Griesbach, D. Packer, P. Berrien, D. Johnson, W. Morse. 1999. Pollock, Pollachius virens, life history and habitat characteristics. NOAA Technical Memorandum, NMFS-NE-131: 1-30.
  • Collette, B., G. Klein-MacPhee. 2002. Pollock, Pollachius virens . Pp. xxxx in B Collette, G Klein-MacPhee, eds. Bigelow and Schroeder's fishes of the Gulf of Maine. Washington, D.C.: Smithsonian Institution Press.
  • Mayo, R., J. McGlade, S. Clark. 1989. Patterns of exploitation and biological status of pollock (Pollachius virens (L.)) in the Scotian Shelf, Georges Bank, and Gulf of Maine area. J. Northwest Atl. Fish. Sci., 9: 13-36.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spawns offshore (depth of 100 to 200 m) from January in the south to May in the north.
  • Bigelow, H. B. and Schroeder,W.C., 1953; Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba, 1990; Frimodt, C., 1995.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pollachius virens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCGCTGATTTTTCTCGACCAATCACAAAGACATTGGCACCCTCTATCTCGTATTTGGTGCCTGAGCCGGCATAGTCGGAACAGCCCTAAGCCTGCTCATTCGAGCAGAGYTAAGTCAACCCGGCGCACTCCTTGGTGAC---GATCAAATTTACAATGTGATCGTTACAGCACACGCTTTCGTAATAATTTTCTTTATAGTAATACCACTGATAATTGGAGGCTTTGGAAACTGACTCATTCCTTTAATGATCGGTGCCCCAGATATGGCCTTCCCTCGAATAAACAACATAAGTTTCTGACTTCTCCCTCCCTCTTTCCTCCTCCTTTTAGCATCATCCGGTGTAGAAGCCGGAGCTGGAACAGGCTGAACTGTTTATCCCCCTCTAGCTGGAAACATGGCTCACGCTGGGGCTTCTGTTGATCTTACCATTTTCTCTCTTCATTTAGCAGGGATTTCATCAATTCTTGGGGCAATTAATTTTATTACCACAATTATTAATATGAAACCTCCAGCAATTTCACAATATCAAACACCCCTCTTTGTGTGAGCAGTACTAATTACAGCTGTGCTTCTATTATTATCCCTTCCCGTCTTAGCAGCCGGTATTACAATACTCCTAACCGATCGTAATCTTAATACTTCCTTCTTTGATCCTGCAGGAGGGGGTGATCCCATTTTATATCAACATTTATTCTGATTCTTCGGCCATCCTGAAGTATATATTCTTATTTTACCCGGATTCGGGATAATTTCCCACATCGTAGCATACTATTCAGGTAAAAAAGAACCCTTTGGATATATAGGCATGGTCTGAGCTATGATAGCCATTGGCCTTCTTGGCTTTATTGTATGAGCCCATCACATGTTTACAGTTGGAATGGACGTAGACACACGTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pollachius virens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 43
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 8 specimens with morphological vouchers housed at Bermuda Aquarium, Museum and Zoo and Ocean Genome Legacy
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Habitat loss or degradation of nearshore intertidal zones that serve as a refuge for juvenile pollock are a current concern, and there is a call for more research related to this topic (Cargnelli et al. 1999). There is some speculation that these habitats may be a bottleneck restricting population size. There are additional concerns regarding the effect of overfishing on pollock population sizes. After catch rates increased steadily throughout the 1970s and early 1980s, catch rates dropped 82% between 1986 and 1996 (Mayo 1998). This was accompanied by a 36% decrease in spawning stock biomass between 1986 and 1994. There is speculation that overfishing may be causing important changes in population structure as well, for example the decrease in mean age at maturity and mean size at maturity observed by Caragnelli et al. (1999).

US Federal List: no special status

CITES: no special status

  • Mayo, R. 1998. Pollock. Pp. 67-69 in S Clark, ed. Status of the fishery resources off the northeastern United States for 1998. Tech. Mem. NMFS-NE-115: NOAA.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no negative impacts of Atlantic pollock on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pollock are an extremely important fish in commercial fisheries, and commercial fisheries on both sides of the Atlantic are well developed. The degree to which pollock are integrated into the fisheries of many nations is evidenced by the several dozen common names in several languages for P. virens. They are also an important gamefish (Steele 1963).

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: highly commercial; gamefish: yes; price category: low; price reliability: reliable: based on ex-vessel price for this species
  • Food and Agriculture Organization of the United Nations 1992 FAO yearbook 1990. Fishery statistics. Catches and landings. FAO Fish. Ser. (38). FAO Stat. Ser. 70:(105):647 p. (Ref. 4931)
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pollachius virens

Coalfish redirects here; that is also a common name for Anoplopoma fimbria (sablefish) in Canada.

Saithe (/sð/[1][2] or /sθ/),[3] Pollachius virens, is a species of marine fish in the Pollachius genus. Together with Pollachius pollachius it is generally referred to in the U.S. as pollock. Other names include the Boston blues (separate from bluefish), coalfish (or coley) and saithe in the UK.[4]

This species can be separated from P. pollachius by looking at the relative lengths of the upper and lower jaws. P. pollachius has a longer underslung lower jaw while Pollachius virens has approximately equal upper and lower jaw lengths. This gives a very different profile to the head. In general P. pollachius is a brown or golden colour with a dark back while P. virens is bright silver with a very dark green back. P. virens generally appears to have relatively larger eyes. The lateral line of P. pollachius has a noticeable kink over the pectoral fins while that of P. virens is straighter. The flesh of coalfish (P. virens) is darkly coloured (hence the common name) while that of P. pollachius is similar to other members of the cod family. This dark colour in the fresh uncooked flesh may have led to the undeserved reputation of this fish as poor for eating.

It is common in the northern parts of the Northern Atlantic, including the Bay of Biscay and Palmas Altas Campus. Adults can grow up to 130 centimetres (51 in) and weigh up to 32 kilograms (71 lb); the species is of great commercial value to fisheries.[5] The fish can be found close to the shore, particularly in rocky areas, but larger examples tend to be found around off-shore wrecks and reefs. The largest coalfish ever caught was 50 pounds (23 kg) at Saltstraumen.

Fisheries[edit]

Global capture of saithe (pollock) in tonnes reported by the FAO, 1950–2010[6]

As food[edit]

To achieve a salmon-like orange color, it can be salted and smoked. In Germany the fish is commonly sold as Seelachs (literally 'sea salmon'), although it is not closely related to any salmon.

Notes[edit]

  1. ^ "saithe". English Online. Oxford Dictionaries. Retrieved 29 January 2014. 
  2. ^ "Key to pronunciations (US English dictionary)". Oxford Dictionaries. Retrieved 29 January 2014. 
  3. ^ "saithe". http://dictionary.reference.com/. dictionary.com/. Retrieved 29 January 2014. 
  4. ^ Davidson, Alan (1999). Oxford Companion to Food. Oxford University Press. p. 682. ISBN 0-19-211579-0. 
  5. ^ Froese, Rainer and Pauly, Daniel, eds. (2010). "Pollachius virens" in FishBase. October 2010 version.
  6. ^ Theragra chalcogramma (Pallas, 1811) FAO, Species Fact Sheet. Retrieved April 2012.

Other references[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!