Overview

Comprehensive Description

Biology

Adults are found on the continental shelves from the intertidal region to at least 200 m depth. They feed on crabs, ghost shrimps, mantis shrimps, isopods, squids, polychaete worms, tunicates and small bony fishes. Viviparous (with a yolk-sac placenta), with 3 to 5 young in a litter. Size at birth between 19 and 21 cm. Readily kept in captivity. Utilized for human consumption. Marketed fresh, smoked and frozen (Ref. 9987).
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 2 - Carcharhiniformes. FAO Fish. Synop. 125(4/2):251-655. Rome: FAO. (Ref. 244)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

  Common names: smoothhound (English), tiburón (Espanol), musola (Espanol)
 
Mustelus henlei (Gill, 1863)


Brown smoothhound


Elongate, slender body; snout pointed, short; eyes large, horizontal ovals, with ventral nictitating membranes; narrow between eyes, width = 3.9-5.6% of TL;  mouth angular, short; upper lip fold distinctly longer than lower lip fold; teeth high, triangular, pointed; nostrils widely spaced; 5 gill slits, last 2 over pectoral fin base; 2 large dorsal fins, second slightly smaller than first; first dorsal broadly triangular, nearer pelvic than pectoral; distance between dorsal fins = 19-24% of TL; anal fin smaller than and with origin under middle of second dorsal; dorsal fins, and sometimes anal and tail, with fibrous rear edges; tail strongly asymmetrical, lower tail lobe not expanded, not with concave rear edge; skin denticles on flank with 3 points, canal along entire center.

Copper brown above, white below; fibrous rear edges to dorsal, anal and tail fins dark.



Size: 95 cm.

Habitat: continental shelf, demersal, especially enclosed bays and shallow muddy bottoms.

Depth: 0-281 m.

Temperate eastern Pacific; California to Baja and the Gulf of California; Panama to Peru.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Eastern central Pacific: Coos Bay, Oregon, USA to Gulf of California, Mexico (Eschmeyer et al. 1983). Southeast Pacific: Ecuador and Peru (Compagno in prep.).

This is one of the most commonly found sharks in bays and estuaries, particularly in San Francisco, Tomales, and Humboldt Bay (Compagno 1984, Love 1991). Nursery areas have been reported from central and northern California, specifically in Tomales Bay (Bane and Bane, 1971), San Francisco Bay (De Wit 1975, Yudin 1987) and Humboldt Bay (Yudin 1987). At the moment there are no known nursery areas for M. henlei in the Gulf of California.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, East Pacific endemic, TEP non-endemic

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California + Peruvian provinces, primarily, Continent, Continent only

Residency: Vagrant

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province ), Antitropical (North and South temperate)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: northern California, USA to the Gulf of California; Ecuador and Peru.
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 2 - Carcharhiniformes. FAO Fish. Synop. 125(4/2):251-655. Rome: FAO. (Ref. 244)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 281 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 95.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 950 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

100.0 cm TL (male/unsexed; (Ref. 31395)); max. reported age: 13 years (Ref. 6098)
  • Smith, S.W., D.W. Au and C. Show 1998 Intrinsic rebound potential of 26 species of Pacific sharks. Mar. Freshwat. Res. 49:663-678. (Ref. 31395)
  • Yudin, K.G. and G.M. Cailliet 1990 Age and growth of the gray smoothhound, Mustelus californicus, and the brown smoothhound, M. henlei, from central California. Copeia 1990(1):191-204. (Ref. 6098)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Mustelus henlei
Catalog Number: USNM 4487
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: San Francisco, San Francisco County, California, United States, Pacific
  • Type: Gill, T. N. 1862. Proceedings of the Academy of Natural Sciences of Philadelphia. 14: 486.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
An abundant inshore to offshore, cold-temperate to warm-temperate or subtropical bottom-dwelling shark of continental shelves, found from the intertidal region to at least 200 m depth, and very common in enclosed, shallow muddy bays (Compagno 1984). In the northern Gulf of California has been caught from 30-266 m but it is mainly distributed at depths greater than 100 m (Pérez-Jiménez 2006). It is seasonally abundant in inshore estuarine waters during the spring and summer when it pups, but moves offshore during the winter months when salinity drops due to increased freshwater runoff (Compagno 1984, Yudin 1987, Flemming 1999, Ebert 2003). Of the three species of smooth hounds off the west coast of North America, it is the most cold-tolerant, being apparently resident in cold-temperate northern California (Compagno 1984, Compagno in preparation).

It is viviparous, with a yolk sac placenta, and litter sizes range from 1-10 (Compagno 1984, Ebert 2003). They grow quite rapidly during the first few years of life, but growth slows at maturity. Age at maturity is 2-3 years for females and three years for males (Pérez-Jiménez 2006, Yudin and Cailliet 1990). Size at maturity is 51-66 cm total length (TL) for females and 52-66 for males (Pérez-Jiménez 2006, Yudin and Cailliet 1990). Longevity is about 13 years and the species reaches a maximum size of 100 cm TL (Yudin and Cailliet 1990). Reproduction is annual, with a gestation period of 10-12 months (Pérez-Jiménez 2006, Yudin 1987) and litter size ranging from 1-10 off central California (Compagno 1984, Ebert 2003) and 1-21 (average 11) in the northern Gulf of California (Pérez-Jiménez 2006). Size at birth is 19-30 cm TL (De Wit 1975, Pérez-Jiménez 2006, Yudin and Cailliet 1990). Average reproductive age (generation period) is estimated at 4.7 years (Cortés 2000). Annual rate of population increase is 1.163 (95% C.I. 1.021-1.427) (Cortés 2000) and natural mortality is 0.295 (Smith et al. 1998).

The movement patterns appear to be fairly localized, although one individual traveled 96 miles in three months. In the Gulf of California, they exhibit seasonal migrations. They move about in discrete groups of sharks of similar age, size, and sex. In San Francisco Bay, the sex ratio changes over time and space, with females predominating at times (4.5:1) and males predominating at other times (1:4). These sharks are an important prey item for the sevengill shark in Humboldt and San Francisco Bays (Ebert 2003).

Off San Francisco, California parturition period reportedly occurs from March to May (Bane and Bane 1971) or from May to December (De Wit 1975), and between Santa Cruz and San Francisco, California from January to August (Yudin 1987).

Pregnant females with terminal embryos are abundant (sometimes 50% of sampled individuals) northeast and east of Angel de la Guarda Island (Northern Gulf of California) from late January-late April. So, parturition in the northern Gulf of California has been estimated to occur from late January to late April (Pérez-Jiménez 2006).

Because M. henlei is a fast growing species, with low longevity, early age at first maturity (Yudin and Cailliet 1990) and with a relatively high fecundity (1-21 pups every year and more in the largest females, in the northern Gulf of California according to Pérez-Jiménez 2006), it has a high capacity for recovery from fishing pressure (Smith 1998).

The diet of this species in California waters consist of crustaceans, cephalopods, echiuran and polychaete worms, bony fishes and their eggs, tunicates and bivalves (Herald and Ripley 1951, De Wit 1975, Talent 1982, Russo 1975, Haeseker and Czech 1993, Ebert 2003).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 0 - 281 m (Ref. 96339)
  • Love, M.S., C.W. Mecklenburg, T.A. Mecklenburg and L.K. Thorsteinson 2005 Resource Inventory of Marine and Estuarine Fishes of the West Coast and Alaska: A Checklist of North Pacific and Arctic Ocean Species from Baja California to the Alaska-Yukon Border. U.S. Department of the Interior, U.S. Geological Survey, Biological Resounces Division, Seattle, Washington, 98104. (Ref. 96339)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 3 - 90
  Temperature range (°C): 15.733 - 22.948
  Nitrate (umol/L): 0.860 - 22.642
  Salinity (PPS): 34.213 - 35.311
  Oxygen (ml/l): 1.472 - 5.078
  Phosphate (umol/l): 0.521 - 1.847
  Silicate (umol/l): 4.304 - 17.907

Graphical representation

Depth range (m): 3 - 90

Temperature range (°C): 15.733 - 22.948

Nitrate (umol/L): 0.860 - 22.642

Salinity (PPS): 34.213 - 35.311

Oxygen (ml/l): 1.472 - 5.078

Phosphate (umol/l): 0.521 - 1.847

Silicate (umol/l): 4.304 - 17.907
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 200m.
Recorded at 200 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Soft bottom only, Mud, Sand & gravel

FishBase Habitat: Demersal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Carnivore

Diet: mobile benthic worms, mobile benthic crustacea (shrimps/crabs), octopus/squid/cuttlefish, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Viviparous with a yolk-sac placenta; with 3 to 5 young in a litter. Size at birth ranges from 19-21 cm (Ref. 244). Distinct pairing with embrace (Ref. 205). Polyandry is a common life history strategy among the elasmobranchs and for M. henlei, the occurrence and frequency of polyandric behavior may vary depending on location and density of breeding individuals (Ref. 95902).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 13 years (wild) Observations: Unverified estimates suggest these animals may live up to 15 years (http://www.fishbase.org/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg Type: Live birth, No pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mustelus henlei

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GATATTGGCACCCTTTACTTGATTTTTGGTGCATGAGCAGGCATAGTTGGGACAGCTCTAAGCCTTCTAATTCGAGCCGAACTTGGACAGCCAGGATCACTCTTAGGTGATGATCAGATTTACAATGTGATCGTAACCGCCCATGCTTTTGTAATAATCTTCTTCATGGTTATACCAATCATGATTGGAGGCTTTGGGAATTGACTGGTTCCCTTGATAATTGGTGCTCCAGATATAGCTTTCCCACGTATGAATAACATAAGCTTCTGACTCCTCCCACCATCATTTCTTCTTCTCCTTGCTTCTGCAGGAGTGGAAGCCGGTGCAGGCACCGGCTGAACAGTATACCCACCACTAGCTAGCAATCTAGCCCATGCTGGACCATCTGTTGATTTAGCCATCTTCTCCCTTCATTTAGCCGGTATTTCATCAATCTTAGCCTCAATTAACTTTATTACAACTATTATTAATATAAAACCACCAGCCATTTCCCAATATCAAACACCATTATTTGTTTGATCAATTCTCGTAACTACTGTCCTTCTTCTTCTCTCCCTGCCAGTTCTTGCAGCAGGGATTACAATATTACTCACAGACCGAAACCTTAATACTACATTCTTTGACCCCGCAGGAGGAGGGGACCCCATCCTTTACCAACACTTATTCTGATTCTTCG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mustelus henlei

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Pérez-Jiménez, J.C. & Carlisle, A.B.

Reviewer/s
Stevens, J.D., Pollard, D., Dudley, S. & Valenti, S.V. (Shark Red List Authority)

Contributor/s

Justification
A small common to abundant shark, occurring from Coos Bay, Oregon, USA to the Gulf of California, Mexico in the Eastern Central Pacific and from Ecuador to Peru in the Southeast Pacific. Found from the intertidal region to 278 m depth, and very common in enclosed, shallow muddy bays. Although the species is heavily fished in areas of the Gulf of California, there is apparently no evidence to indicate that the population has undergone significant decline. The species is not commercially fished off California, but is taken as bycatch and by recreational anglers (but not in significant numbers). It is not thought that the species is being over-fished off the USA. This is a fast growing species, with low longevity, early age at first maturity and with a relatively high fecundity, giving it a high capacity for recovery from fishing pressure. These life history characteristics combined with the fact that there have been no suspected, observed, or inferred declines in catches or populations in any region for M. henlei justify an assessment of Least Concern at present.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
A common to abundant shark where it occurs. The microdistribution and population structure of this species may be very localized and spotty (Compagno in prep.). It is locally abundant in bays north of Monterey, California, with extensive populations in San Francisco, Tomales, and Humbolt bays (Castro 1996). No decline in catches or population has been observed in any region for M. henlei.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Interest to fisheries is considerable (Compagno in prep.). The species is fished commercially in the Gulf of California, Mexico (Compagno in prep.). Off California they are probably taken as bycatch, although there is no commercial fishery for this species (Ebert 2003). They are primarily caught by recreational anglers in San Francisco Bay and elsewhere along the coast, but not in significant numbers (Ebert 2003).

In the northern Gulf of California, Mexico, Mustelus species have been caught by the artisanal fleet since the 1980s (Cudney and Turk 1998) and by medium size trawler vessels since 1996, when 59 shrimp trawler vessels obtained fishing permits to catch finfish and elasmobranch species during the non-shrimp fishing season. This small shark species is also caught as bycatch, although it is believed that only small numbers are caught because the trawling operations for catching shrimp are shallower than the main distribution area of this small shark species (Sustentabilidad y Pesca Responsible en México: Evaluación y manejo 1997-1998).

In the northern Gulf of California it is commonly caught (the highest catches being of 150 kgh-1) in demersal trawlers operating from January to June at depths greater than 100 m, which are targeting Pacific Hake (Merluccius productus). The species is very commonly caught by the artisanal fishery in the upper Gulf of California, which targets "Baqueta" (Epinephelus acanthistius) using bottom set longlines. It is sometimes quite abundant in these catches from November to March (Cudney and Turk 1998). In this region it is less commonly caught in bottom gill-nets.

Marquez-Farias (2000) stated that in the Sonora state (northeastern Gulf of California) M. henlei was the most abundant shark species caught with gill-nets by the artisanal fishery at depths greater than 80 m. This mainly occurs during the autumn and winter months when this, and other small shark species (Rhizoprionodon longurio, M. lunulatus and M. californicus), make seasonal migrations. During this period, catch rates as high as 1,200-1,500 individuals per fishing trip have been reported. In the Pacific, off Santa Rosalillita, Baja California (approximately 400 km south of Ensenada) there are high catch rates of Mustelus species (possibly mainly M. californicus and M. henlei). During the period from May to September of 2001, 4,638 kg of Mustelus species were caught (Rodríguez-Medrano and Almeda-Jauregui 2002).

Various fisheries (mainly artisanal) along the coasts of Ecuador and Peru land sharks, including houndsharks, as bycatch. In some cases sharks have been specifically targeted, however target fisheries for sharks were prohibited in Ecuador in 2004 (see Conservation Measures section).

Catch statistics are generally limited, with inadequate monitoring of fishing activities and landings. Bostock and Herdson (1985) estimated that in the early 1980s small-scale fishers landed some 1,800-2,000 t of sharks per year off Ecuador. Later catch estimates from only a subset of landing ports amounted to ~4,000 t/year for 1993-1995. Martínez (1999) noticed a reduction in shark landings in small-scale coastal fisheries in Ecuador in more recent years when compared with those of the early 1980s.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No specific measures in place.

There is little effective management of inshore fishing activities in Ecuador and Peru. Specific management regulations have been lacking, but the recent development of a shark plan for Ecuador and recently introduced measures should lead to improvements. In Ecuador, Decree 2130 banned target fisheries and fin trade in 2004, but implementation and enforcement was insufficient and fins continued to be exported illegally. The export of fins is not banned in Peru. Subsequently, Decree 486 permitted trade in fins from bycatch, mandated the full utilisation of all shark meat, and required monitoring of all bycatch and a licensing system for the trade of fins. This decree provided an important means of monitoring shark catches.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; gamefish: yes; price category: low; price reliability: reliable: based on ex-vessel price for this species
  • Coppola, S.R., W. Fischer, L. Garibaldi, N. Scialabba and K.E. Carpenter 1994 SPECIESDAB: Global species database for fishery purposes. User's manual. FAO Computerized Information Series (Fisheries). No. 9. Rome, FAO. 103 p. (Ref. 171)
  • Frimodt, C. 1995 Multilingual illustrated guide to the world's commercial warmwater fish. Fishing News Books, Osney Mead, Oxford, England. 215 p. (Ref. 9987)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Brown smooth-hound

The brown smooth-hound (Mustelus henlei) is a houndshark of the family Triakidae. It is found on the continental shelves of the subtropical eastern Pacific, from northern California to the Gulf of California, as well as Ecuador and Peru between latitudes 43° N and 18° S, from the surface to a depth of 200 m. It can grow up to a length of 1 m. The reproduction of this shark is viviparous.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!