Overview

Comprehensive Description

Biology

Found on continental and insular shelves and upper slopes, ranging from shallow inshore waters and the intertidal to 200 m, occasionally down to 579 m (Ref. 244). Occasionally found in freshwater. It is doubtful that this species can live in fresh water for an extended period of time (Ref. 244). Feeds on large crustaceans, mainly crabs, but also heavily on lobsters (Homarus) (Ref. 244). Probably non-territorial. Off the Atlantic coast of the USA, this species is migratory (Ref. 244). Viviparous (with a yolk-sac placenta), with 4 to 20 young in a litter. Longevity given as 7 years (Ref. 775) but appears too low. Utilized fresh, dried-salted, and smoked (Ref. 9987).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Massachusetts to southern Brazil
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Dusky Smoothhounds are found in the western Atlantic from Massachusetts to Florida, USA, in the northern Gulf of Mexico including Cuba, Jamaica, Barbados, Bermuda, Bahamas and southern Brazil to northern Argentina (Compagno 1984b). There are probably several discrete populations separated by large areas geographically with little movement between different populations (Bigelow and Schroeder 1948). Dusky smoothhounds are primarily demersal sharks that inhabit continental and insular shelves and upper slopes and are typically found in inshore waters down to 200 m depth (Compagno 1984b).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic, from Massachussetts, U.S.A. to Argentina.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Massachusetts to Florida (USA), northern and western Gulf of Mexico, Venezuela, Cuba, Jamaica, Barbados, Bermuda, Bahamas; southern Brazil to northern Argentina; also western Gulf of Mexico and Antilles (Ref. 26938). Northwest Atlantic: Canada (Ref. 5951). Allopatric with Mustelus mustelus and sympatric with Mustelus norrisi. One of the two new allopatric species of canis- norrisi-like smooth-hounds in this region is often confused with this species (Ref. 244). The subspecies Mustelus canis insularis, occurring at several Caribbean islands, was identified by Heemstra (Ref. 27770).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic, from Massachussetts, U.S.A. to Argentina.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Coastal waters of the western Atlantic, from Uruguay and southern Brazil, regularly to Cape Cod, rarely to Passamaquoddy Bay; Bermuda.
  • Bigelow, H. B. and Schroeder,W.C.,1953 ; Compagno, L.J.V., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 1500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

150 cm TL (male/unsexed; (Ref. 244)); max. published weight: 12.2 kg (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

to 150 cm TL; max.weight: 8,070 g.
  • Bigelow, H. B. and Schroeder,W.C.,1953 ; Compagno, L.J.V., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

A small, slim shark. Well-serrated dorsal fins, second nearly as large as first (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Mustelus canis
Catalog Number: USNM 208013
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Unknown
Collector(s): W. Anderson & F. Williams
Year Collected: 1967
Locality: Cay Sal Bank, N.W. of Double Headed Shot Cays, Bahama Islands, Bahamas, Bahamian Archipelago, Atlantic
Depth (m): 214 to 214
  • Paratype: Heemstra, P. C. 1997. Bulletin of Marine Science. 60 (3): 903, fig. 5.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Holotype for Mustelus canis
Catalog Number: USNM 208012
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Unknown
Collector(s): F. Williams
Year Collected: 1966
Locality: Cay Sal Bank, 5 Miles NW. of Cay Sal Island, Bahama Islands, Bahamas, Bahamian Archipelago, Atlantic
Depth (m): 214 to 214
  • Holotype: Heemstra, P. C. 1997. Bulletin of Marine Science. 60 (3): 903, fig. 5.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Mustelus canis
Catalog Number: USNM 37679
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): Public Museum, Institute of Jamaica
Locality: Jamaica, Greater Antilles, Caribbean Sea, Atlantic
  • Paratype: Heemstra, P. C. 1997. Bulletin of Marine Science. 60 (3): 903, fig. 5.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Mustelus canis
Catalog Number: USNM 154808
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): G. Goode
Year Collected: 1872
Locality: Bermudas, Bermuda, Atlantic
  • Paratype: Heemstra, P. C. 1997. Bulletin of Marine Science. 60 (3): 903, fig. 5.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Mustelus canis
Catalog Number: USNM 21376
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): G. Goode
Year Collected: 1877
Locality: Bermuda, Bermuda Islands, Atlantic
  • Paratype: Heemstra, P. C. 1997. Bulletin of Marine Science. 60 (3): 903, fig. 5.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Mustelus canis
Catalog Number: USNM 25234
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): F. Poey
Locality: Cuba, Greater Antilles, Caribbean Sea, Atlantic
  • Paratype: Heemstra, P. C. 1997. Bulletin of Marine Science. 60 (3): 903, fig. 5.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found at depths of 0- 579m.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The maximum reported size of Dusky Smoothhound is about 150 cm total length (TL) (Compagno 1984b). Data on longevity of the species is sparse in the literature. Dusky Smoothhounds are viviparous sharks that form a yolk-sac placenta and have litters ranging in size from 4?20, but averaging 10?20 per litter. The north Atlantic population has a yearly seasonal reproductive cycle with the mating season occurring from mid to late summer. The gestation period is about 10 months with parturition occurring from early May to the middle of July (Bigelow and Schroeder 1948). Female Dusky Smoothhounds reach maturity at about 102 cm and males reach maturity about 84 cm (Conrath unpubl.). Rountree and Able (1996) suggest that Mid-Atlantic Bight estuaries may serve as critical nursery grounds for this species. They report the size at birth to be around 28?39 cm. The north Atlantic population undergoes a seasonal migration responding to changes in the water temperature. This population winters between Chesapeake Bay and South Carolina. In early spring Dusky Smoothhounds begin migrating to their summer grounds between Delaware Bay and Cape Cod, remaining there until late autumn before migrating south again (Bigelow and Schroeder 1948, Castro 1983). Dusky smoothhounds possess low, flattened teeth specialised for crushing crustacean prey. Their diet consists primarily of large crustaceans but also includes squid, small bony fish (menhaden, stickleback, wrasses, porgies, sculpins and puffers), gastropods, bivalves, marine annelid worms and occasionally garbage (Bigelow and Schroeder 1948). Gelsleichter et al. (1999) found that adult dusky smoothhounds captured in Virginia waters had a diet dominated by crustaceans, especially by rock crabs, lady crabs and blue crabs, but also included other crustaceans, molluscs, teleosts, horseshoe crabs and polychaetes.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; oceanodromous (Ref. 51243); brackish; marine; depth range ? - 800 m (Ref. 55584), usually 18 - 200 m (Ref. 55309)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2822 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1445 samples.

Environmental ranges
  Depth range (m): 1 - 620
  Temperature range (°C): 4.345 - 24.665
  Nitrate (umol/L): 0.289 - 27.648
  Salinity (PPS): 32.397 - 36.842
  Oxygen (ml/l): 2.619 - 6.835
  Phosphate (umol/l): 0.099 - 1.653
  Silicate (umol/l): 0.756 - 18.348

Graphical representation

Depth range (m): 1 - 620

Temperature range (°C): 4.345 - 24.665

Nitrate (umol/L): 0.289 - 27.648

Salinity (PPS): 32.397 - 36.842

Oxygen (ml/l): 2.619 - 6.835

Phosphate (umol/l): 0.099 - 1.653

Silicate (umol/l): 0.756 - 18.348
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 579m.
Recorded at 579 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Demersal; brackish; marine; depth range-579 m. Continental shelves and slopes; shallow inshore waters and the intertidal to depth of 200 m., occasionally deeper.
  • Bigelow, H. B. and Schroeder,W.C.,1953 ; Compagno, L.J.V., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found on continental and insular shelves and upper slopes, ranging from shallow inshore waters and the intertidal to 200 m, occasionally down to 579 m (Ref. 244). Occasionally found in freshwater. It is doubtful that this species can live in fresh water for an extended period of time (Ref. 244). Feeds on large crustaceans, mainly crabs, but also heavily on lobsters (Homarus) (Ref. 244). Probably non-territorial. Off the Atlantic coast of the USA, this species is migratory (Ref. 244).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Large crustaceans, mainly crabs and lobsters.
  • Bigelow, H. B. and Schroeder,W.C.,1953 ; Compagno, L.J.V., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Mustelus canis (Smooth Dogfish) is prey of:
Urophycis chuss
Squalus acanthias
Lophius americanus
Pomatomus saltatrix
Scombridae
Chondrichthyes
Homo sapiens

Based on studies in:
USA, Northeastern US contintental shelf (Coastal)

This list may not be complete but is based on published studies.
  • Link J (2002) Does food web theory work for marine ecosystems? Mar Ecol Prog Ser 230:1–9
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

  • Link J (2002) Does food web theory work for marine ecosystems? Mar Ecol Prog Ser 230:1–9
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on large crustaceans, mainly crabs, but also heavily on lobsters
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Viviparous (Ref. 26281, 35307, 50449), with a yolk-sac placenta; with 4 to 20 young per litter. Distinct pairing with embrace (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 16 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Viviparous, 4 to 20 young in a litter.
  • Bigelow, H. B. and Schroeder,W.C.,1953 ; Compagno, L.J.V., 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mustelus canis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTGATTTTTGGTGCATGAGCAGGCATAGTTGGGACAGCTCTAAGCCTTCTAATTCGAGCCGAACTTGGGCAGCCAGGTTCACTCTTAGGTGATGATCAGATTTATAATGTGATCGTAACCGCCCATGCTTTTGTAATAATCTTCTTTATGGTTATACCAATCATGATCGGAGGCTTTGGGAATTGACTGGTCCCCTTGATAATTGGTGCTCCAGATATAGCTTTCCCACGTATGAATAACATAAGCTTCTGACTCCTCCCACCATCATTTCTCCTTCTCCTTGCTTCTGCAGGAGTGGAAGCCGGTGCAGGCACCGGCTGAACAGTATATCCACCACTAGCTAGCAACCTAGCCCATGCTGGACCATCTGTTGATTTAGCCATCTTCTCCCTTCATTTAGCCGGTATTTCATCAATCTTAGCCTCAATTAACTTTATTACAACTATTATTAATATAAAACCACCAGCCATTTCCCAATATCAAACACCATTATTTGTTTGATCAATTCTCGTGACTACTGTTCTTCTTCTTCTCTCCCTGCCAGTTCTTGCAGCAGGGATTACAATATTACTCACAGACCGAAACCTTAATACTACATTCTTTGACCCCGCTGGGGGAGGGGATCCCATCCTTTACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mustelus canis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 19
Specimens with Barcodes: 28
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Bermuda Aquarium, Museum and Zoo
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2005

Assessor/s
Conrath, C.

Reviewer/s
Musick, J.A. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
This assessment is based on the information published in the 2005 shark status survey (Fowler et al. 2005).

The Dusky Smoothhound (Mustelus canis) is a demersal coastal shark found in many areas of the western Atlantic. An abundant species seasonally in many areas of the northwest Atlantic, in recent years they have become commercially important in this region. Recent rapid increases in directed gillnet fishing has caused a decline in some stocks of large females. There is currently no management plan or protection for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Historically this species has not been utilized in fisheries, except for collection to use in classroom exercises (Bigelow and Schroeder 1948). Compagno reports that this species is fished off Cuba, Venezuela, Brazil and possibly other locations in the Caribbean, using longline gear and bottom-trawls and is utilised as a food resource (Compagno 1984b). Recently a gillnet fishery for dusky smoothhounds has started on the eastern shore of Virginia and North Carolina. Total landings of Dusky Smoothhounds in Virginia waters remained fairly low (less than 25,000 lbs or 11 t) until 1993 when landings exceeded 220,000 pounds (100 t). Total landings remained around this level for two more years but decreased to around 140,000 pounds (63.5 t) in 1996 (Virginia Marine Resources Commission unpubl.). In North Carolina Dusky Smoothhound landings have only been reported separately from Spiny Dogfish (Squalus acanthias) landings since 1995. In 1995 total landings reached 2,182,577 lb (990 t) but dropped in 1996 to 463,047 pounds (210 t) (North Carolina Division of Marine Fisheries unpubl.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No demographic modelling has been done to predict how the North Atlantic population of Dusky Smoothhounds will respond to this recent increase in fishing pressure and what management measures will be most appropriate. Currently there is no management for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Dusky smooth-hound

The dusky smooth-hound or smooth dogfish, Mustelus canis, is a species of houndshark, and part of the family Triakidae.[1] This shark is an olive grey or brown in color, and may have shades of yellow or grayish white. Females live to 16 years and males have a lifespan of 10 years. Mustelus canis was the first shark recognised to have viral infections.[2]

Size and growth[edit]

Length for the dusky smooth-hound is up to 1.5 m (5.0 ft), with a maximum weight of 12 kg (27 lb). Dusky smooth-hound sharks reach maximum size at seven or eight years of age. Average size of this shark is around 1.2 m (4 ft). This species grows quickly, with males reaching maturity at two to three years of age, and females at four to five years of age.

Habitat[edit]

A common resident in bays and other inshore waters, the dusky smooth-hound prefers shallow waters of less than 18 m (60 ft) in depth, but may be found to depths of 200 m (650 ft). This species has also been found on occasion in fresh water, although they are unlikely to survive fresh water for extended periods. The dusky smooth-hound migrates seasonally, moving north in the spring and south in the autumn. It is primarily a nocturnal species.

Food[edit]

A scavenger and opportunistic predator, the dusky smooth-hound feeds primarily on large crustaceans, including lobsters, shrimp, and crabs, as well as small fish, mollusks, and small fish that have been injured. The flat, blunt teeth of the dogfish are used to crush and grind these prey items which have tough outer body coverings. Small fish that are preyed upon by the dusky smooth-hound include menhaden and tautog. Young dusky smooth-hounds feed on small shrimp, worms, and crabs.

Reproduction[edit]

Mating occurs throughout most of the dusky smooth-hound's range from May through July. Following a gestation period of 10 to 11 months, a litter numbering as few as four and as many as 20 is born during late spring or early summer. Larger females tend to have larger litters.

Importance to humans[edit]

In certain areas, the flesh of dusky smooth-hound is marketed as fresh or dried and salted for human consumption. The dusky smooth-hound is often used as a laboratory animal and in public display at aquaria.

See also[edit]

References[edit]

  1. ^ a b Conrath, C. (2005). "Mustelus canis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 23 May 2014. 
  2. ^ L. Leibovitz & S. S. Lebouitz (1985). "A viral dermatitis of the smooth dogfish, Mustelus canis (Mitchill)". Journal of Fish Diseases 8 (3): 273–279. doi:10.1111/j.1365-2761.1985.tb00943.x. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!