Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabit lagoon and seaward reefs, mainly in coral rich areas (Ref. 1602). Feed on algae. Oviparous (Ref. 240), monogamous (Ref. 52884). Frequently exported through the aquarium trade. Form hybrids with Centropyge eibli and C. flavissima at areas of sympatry. Mimicked by juveniles of the acanthurid Acanthurus pyroferus (Ref. 48391).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is distributed in the Indo-west Pacific region from Christmas Island (Australia) in the west, throughout the Indo-Australian Archipelago, to Vanuatu and the Marshall Islands in the east, and from southern Japan and the island of Taiwan in the north to Lord Howe Island (Australia) in the south (Steene 1978, Pyle 2001, G.R. Allen pers. comm. 2006). Recently recorded from Tonga (Randall et al. 2003). Ranges in depth between 1-25 m.(G.R. Allen pers. comm. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

West Pacific and southeastern Indian Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific: Christmas Island in the eastern Indian Ocean and Bali to the Marshall Islands and Vanuatu, north to southern Japan, south to Lord Howe Island. Recently recorded from Tonga (Ref. 53797).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 14; Dorsal soft rays (total): 15 - 16; Analspines: 3; Analsoft rays: 16 - 17; Vertebrae: 24
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 100 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

12.0 cm TL (male/unsexed; (Ref. 48636))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Pale tan or light brown becoming blackish on the posterior third of the body and the adjacent fins. Scales on the light portion with white centers. The edge of the gill opening, and the base of the pectoral fins orange. The rear portion of the dorsal and anal fins, and the caudal fin with submarginal narrow blue line. Juvenile similar to adult (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Coral rich areas of lagoons and seaward reefs, occasionally in surge channels. Most common in shallows (above 20 m), but also occurs below 25 m. Usually occurs in harem groups comprised of a single male and several females. Feeds mostly on filamentous algae (G.R. Allen pers. comm. 2006).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 3 - 25m.
From 3 to 25 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 3 - 25 m (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 132 specimens in 1 taxon.
Water temperature and chemistry ranges based on 87 samples.

Environmental ranges
  Depth range (m): 0.5 - 35
  Temperature range (°C): 25.709 - 29.336
  Nitrate (umol/L): 0.019 - 0.895
  Salinity (PPS): 32.886 - 35.312
  Oxygen (ml/l): 4.290 - 4.772
  Phosphate (umol/l): 0.055 - 0.284
  Silicate (umol/l): 0.888 - 4.892

Graphical representation

Depth range (m): 0.5 - 35

Temperature range (°C): 25.709 - 29.336

Nitrate (umol/L): 0.019 - 0.895

Salinity (PPS): 32.886 - 35.312

Oxygen (ml/l): 4.290 - 4.772

Phosphate (umol/l): 0.055 - 0.284

Silicate (umol/l): 0.888 - 4.892
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits lagoon and seaward reefs, mainly in coral rich areas (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct pairing (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Centropyge vrolikii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTACTATTCGGTGCTTGAGCTGGGATGGTGGGAACCGCTTTGAGCCTACTTATTCGAGCAGAACTAAATCAACCAGGCAGCCTCTTAGGGGATGACCAAATTTATAATGTAATCGTTACAGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCAGCTATAATTGGAGGGTTCGGAAACTGGCTGATCCCTCTAATAATTGGGGCCCCAGACATGGCATTCCCCCGAATAAACAACATGAGCTTTTGACTCCTCCCCCCTTCCCTCCTCCTTCTCCTCGCCTCCGCGGGGGTAGAAGCTGGGGCCGGGACTGGATGAACAGTTTACCCACCTCTGGCCGGCAATTTAGCCCATGCAGGAGCATCCGTAGATTTAACCATTTTTTCCCTTCACTTAGCAGGGGTCTCCTCAATTTTAGGGGCTATCAATTTTATTACTACTATCATCAACATAAAACCCCCCGCCATTTCCCAATACCAAACGCCACTATTTGTTTGAGCAGTACTAATTACTGCCGTCCTTCTACTTCTCTCCCTCCCAGTCCTTGCTGCAGGAATTACGATACTCCTTACAGACCGGAATCTAAATACCACCTTCTTTGACCCTGCGGGAGGAGGGGATCCAATCCTCTACCAACA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Centropyge vrolikii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Pyle, R., Myers, R. & Rocha, L.A.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification
Listed as Least Concern in view of its wide distribution, large overall population, collection for the aquarium fish trade is not globally impacting the population, and there are no other potential major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

It is generally common with stable populations.


Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

There appear to be no major threats to this species. Although it is regularly collected for the aquarium trade, harvest levels are not considered to be impacting the global population. There is no substantial habitat loss in the range of this species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There appear to be no species-specific conservation measures in place. This species is present within many marine protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Centropyge vrolikii

Centropyge vrolikii, known commonly as the Pearlscale angelfish , is a species of marine fish in the family Pomacanthidae.

The Pearlscale angelfish is widespread throughout the tropical waters of the Indo-West Pacific area.[2]

The Pearlscale angelfish is a small size fish and can reach a maximum size of 12 cm length .[3]

References[edit]

  1. ^ Pyle, R., Myers, R. & Rocha, L.A. 2010. Centropyge vrolikii. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 09 September 2013.
  2. ^ http://eol.org/pages/994606/details#distribution
  3. ^ http://www.fishbase.org/summary/5447
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!