Skip to content

Acanthopagrus latus — Details

Japanese Bream learn more about names for this taxon

Overview

Comprehensive Description

Biology

Learn more about this article

Occurs in shallow coastal waters and enters river mouths and estuaries. Schooling species; often feeds on tidal flats (Ref. 44894, 48635). Feeds mainly on echinoderms, worms, crustaceans and mollusks. Mainly exploited by artisanal fisheries. Sold fresh in markets. Used in Chinese medicine (Ref. 12166). A popular angling species, often caught with hook and line and sometimes taken by trawlers (Ref. 44894).

Bauchot, M.-L. and M.M. Smith 1984 Sparidae. In W. Fischer and G. Bianchi (eds.) FAO species identification sheets for fishery purposes. Western Indian Ocean (Fishing Area 51). volume 4. [var. pag.] FAO, Rome. (Ref. 3507) http://www.fishbase.org/references/FBRefSummary.php?id=3507&speccode=4543

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Distribution

Distribution

Learn more about this article

Djibouti

Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp. http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Learn more about this article

Indo-West Pacific: Persian Gulf and along the coast of India to the Philippines, north to Japan, south to Australia.

Bauchot, M.-L. and M.M. Smith 1984 Sparidae. In W. Fischer and G. Bianchi (eds.) FAO species identification sheets for fishery purposes. Western Indian Ocean (Fishing Area 51). volume 4. [var. pag.] FAO, Rome. (Ref. 3507) http://www.fishbase.org/references/FBRefSummary.php?id=3507&speccode=4543

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Physical Description

Morphology

Learn more about this article

Dorsal spines (total): 11; Analspines: 89

Ye, T. 1991 Sparidae. p. 401-405. In J.-H. Pan, L. Zhong, C.-Y. Zheng, H.-L. Wu and J.-H. Liu (eds). 1991. The freshwater fishes of Guangdong Province. Guangdong Science and Technology Press, Guangzhou. 589 pp. http://www.fishbase.org/references/FBRefSummary.php?id=33461

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Size

Learn more about this article

Maximum size: 450 mm TL

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Max. size

Learn more about this article

50.0 cm TL (male/unsexed; (Ref. 3627)); max. published weight: 1,500 g (Ref. 40637)

IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA. (Ref. 40637) http://www.fishbase.org/references/FBRefSummary.php?id=40637&speccode=943
Mathews, C.P. and M. Samuel 1991 Growth, mortality and length-weight parameters for some Kuwaiti fish and shrimp. Fishbyte 9(2):30-33. (Ref. 3627) http://www.fishbase.org/references/FBRefSummary.php?id=3627&speccode=6465

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Ecology

Habitat

Learn more about this article

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
Depth range (m): 0.9 - 0.9

Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Public Domain

Source: Ocean Biogeographic Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Learn more about this article

Depth: 0 - 50m.
Recorded at 50 meters.

Habitat: demersal.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Environment

Learn more about this article

demersal; freshwater; brackish; marine; depth range ? - 50 m (Ref. 11441)

Randall, J.E. 1995 Coastal fishes of Oman. University of Hawaii Press, Honolulu, Hawaii. 439 p. (Ref. 11441) http://www.fishbase.org/references/FBRefSummary.php?id=11441&speccode=4740

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Trophic Strategy

Learn more about this article

Occurs in shallow coastal waters and enters river mouths and estuaries. Feeds mainly on echinoderms, worms, crustaceans and mollusks (Ref. 3507).

Bauchot, M.-L. and M.M. Smith 1984 Sparidae. In W. Fischer and G. Bianchi (eds.) FAO species identification sheets for fishery purposes. Western Indian Ocean (Fishing Area 51). volume 4. [var. pag.] FAO, Rome. (Ref. 3507) http://www.fishbase.org/references/FBRefSummary.php?id=3507&speccode=4543

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acanthopagrus latus

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 23 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GBGC5121-08|NC_010977|Acanthopagrus latus| ACACGCTGACTTTTCTCAACTAACCATAAAGACATCGGCACCCTTTATCTCGTATTTGGTGCTTGAGCTGGAATAGTAGGAACTGCCTTA---AGCCTGCTCATTCGAGCCGAATTAAGCCAACCTGGAGCTCTCCTAGGAGAC---GATCAAATTTATAATGTTATTGTTACAGCACATGCGTTTGTAATAATTTTTTTTATAGTAATACCAATTATGATTGGAGGCTTCGGAAATTGATTAGTACCACTTATG---ATCGGTGCTCCTGATATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTTCTTCCCCCATCATTCCTCCTACTGCTAGCTTCTTCTGGCGTCGAAGCTGGGGCCGGCACTGGATGGACAGTCTACCCCCCACTGGCAGGAAACCTCGCTCACGCAGGTGCATCAGTTGACCTG---ACTATTTTTTCTCTTCACCTGGCTGGGGTTTCATCTATTCTTGGTGCCATTAATTTTATTACTACCATTATTAATATGAAGCCACCAGCTATTTCACAATATCAAACGCCCCTATTTGTGTGGGCCGTTTTAATTACTGCCGTTCTACTTCTCTTGTCTCTTCCAGTTCTTGCTGCC---GGAATTACAATGCTCCTTACAGATCGAAACCTGAATACCACCTTCTTTGATCCAGCTGGAGGGGGAGACCCTATTCTTTACCAACACTTATTCTGATTCTTCGGACACCCTGAAGTATATATTTTAATTCTTCCAGGGTTCGGTATAATCTCCCACATCGTGGCATACTATTCTGGTAAAAAG---GAACCTTTCGGGTACATAGGAATGGTTTGAGCGATGATGGCCATCGGTCTCTTAGGATTTATTGTATGGGCCCATCACATGTTCACAGTTGGTATAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Statistics of barcoding coverage: Acanthopagrus latus

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 23
Species: 25
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Conservation

Threats

Learn more about this article

Not Evaluated

IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006. http://www.fishbase.org/references/FBRefSummary.php?id=57073

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Relevance to Humans and Ecosystems

Benefits

Importance

Learn more about this article

fisheries: commercial; aquaculture: commercial

Liao, C.-I., H.-M. Su and E.Y. Chang 2001 Techniques in finfish larviculture in Taiwan. Aquaculture 200(2001):1-31. (Ref. 40297) http://www.fishbase.org/references/FBRefSummary.php?id=40297&speccode=1895
Bauchot, M.-L. and M.M. Smith 1984 Sparidae. In W. Fischer and G. Bianchi (eds.) FAO species identification sheets for fishery purposes. Western Indian Ocean (Fishing Area 51). volume 4. [var. pag.] FAO, Rome. (Ref. 3507) http://www.fishbase.org/references/FBRefSummary.php?id=3507&speccode=4543

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Wikipedia

Yellowfin seabream

Learn more about this article

The yellowfin seabream, Acanthopagrus latus (also known as yellow sea bream, silverback razorfish or datina) is a porgy of the Sparidae family.^[1]

Notes

^ Froese, Rainer, and Daniel Pauly, eds. (2009). "Acanthopagrus latus" in FishBase. 5 2009 version.

This Perciformes article is a stub. You can help Wikipedia by expanding it.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!