Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Biology

Viviparous (Ref. 34817).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Southeast Atlantic: South Africa, Tristan da Cunha and Gough Islands. Possibly off southern and western South America.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

South Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13 - 14; Dorsal soft rays (total): 13 - 14; Analspines: 3; Analsoft rays: 6
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 370 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

37.0 cm TL (male/unsexed; (Ref. 4313))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Reddish to brownish and with 5-6 pale spots on upper back (Ref. 4313).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Sebastichthys chamaco
Catalog Number: USNM 77677
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): R. Coker
Year Collected: 1908
Locality: Mollendo, Peru., Peru, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Sebastichthys chamaco
Catalog Number: USNM 77664
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): R. Coker
Year Collected: 1908
Locality: Mollendo, Peru, Peru, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Sebastichthys chamaco
Catalog Number: USNM 77663
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): R. Coker
Year Collected: 1908
Locality: Mollendo, Peru, Peru, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Sebastichthys chamaco
Catalog Number: USNM 77621
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): R. Coker
Year Collected: 1908
Locality: Mollendo, Peru, Peru, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Sebastichthys chamaco
Catalog Number: USNM 77614
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): R. Coker
Year Collected: 1908
Locality: Mollendo, Peru, Peru, Pacific
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; marine; depth range 20 - 275 m (Ref. 4313)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 49 specimens in 1 taxon.
Water temperature and chemistry ranges based on 34 samples.

Environmental ranges
  Depth range (m): 10 - 500
  Temperature range (°C): 6.860 - 14.781
  Nitrate (umol/L): 1.901 - 25.273
  Salinity (PPS): 34.491 - 35.171
  Oxygen (ml/l): 3.323 - 5.939
  Phosphate (umol/l): 0.382 - 2.156
  Silicate (umol/l): 1.537 - 19.523

Graphical representation

Depth range (m): 10 - 500

Temperature range (°C): 6.860 - 14.781

Nitrate (umol/L): 1.901 - 25.273

Salinity (PPS): 34.491 - 35.171

Oxygen (ml/l): 3.323 - 5.939

Phosphate (umol/l): 0.382 - 2.156

Silicate (umol/l): 1.537 - 19.523
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 20 - 275m.
From 20 to 275 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Sebastes capensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Sebastes capensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATCTAGTATTTGGTGGCTGAGCCGGTATAGTAGGCACAGCCCTCAGCCTACTCATTCGAGCAGAACTAAGCCAACCGGGCGCTCTCCTTGGAGACGACCAGATTTATAATGTAATCGTTACAGCACATGCCTTCGTAATGATTTTCTTTATAGTAATGCCAATTATAATTGGAGGTTTTGGAAACTGGTTAATTCCCCTAATGATTGGAGCCCCAGATATAGCATTTCCTCGTATAAATAACATAAGTTTCTGACTTCTACCCCCTTCTTTCCTGCTATTACTTGCCTCTTCTGGAGTAGAAGCGGGTGCCGGAACCGGGTGAACGGTGTACCCGCCCTTAGCCGGTAACTTAGCCCACGCAGGAGCATCAGTCGACCTGACAATCTTTTCACTTCACCTAGCAGGCATTTCCTCAATCCTTGGGGCAATCAATTTTATTACCACAATTATTAATATGAAGCCCCCGGCCATCTCTCAATATCAGACACCCCTGTTTGTGTGAGCCGTCCTAATTACCGCTGTCCTTCTCCTTCTCTCCCTACCAGTTCTCGCTGCCGGCATCACAATGCTCCTTACCGACCGGAATCTTAATACCACCTTCTTTGACCCGGCCGGAGGAGGGGATCCAATCCTTTACCAGCACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sebastes capensis

The false jacopever or Cape redfish (Sebastes capensis) is a marine fish belonging to the family Sebastidae.[1] Found only in waters off the western coast of South Africa, Tristan da Cunha and southern South America, S. capensis lives in depths of 20 to 275 metres (66 to 902 ft).[1][2] It reaches up to 37 centimetres (15 in) in length, and is reddish or brownish with 5-6 pale spots on the upper part of the body.[1] It has extremely prominent eyes. It mainly feeds on mysids.[2]

Etymology and taxonomic history[edit]

The species was originally described by Gmelin in 1789 as Scorpaena capensis.[3] It was later reclassified as Sebastichthys capensis.[4] In 1917, it was redescribed by Evermann and Radcliffe as Sebastes chamaco.[5] The species' common name was derived from the pock-marked acne skin of an old skipper.[citation needed]

Description[edit]

The Cape redfish is a demersal fish that grows to a maximum length of about 37 cm (15 in) though a more normal size is about 30 cm (12 in). The dorsal fin has about thirteen spines and thirteen soft rays and the anal fin has three spines and six soft rays. The general colour of this fish is reddish or brown, and there are five or six pale spots on its back.[1]

Distribution and habitat[edit]

The Cape redfish is found in subtropical waters in the southeastern Atlantic Ocean on the coasts of South Africa, Tristan da Cunha and Gough Island.[1] Another population is present in the southeastern Pacific Ocean off the coast of Chile.[6] The depth range for this species is 20 to 275 m (66 to 902 ft).[1]

Biology[edit]

The Cape redfish feeds on small benthic invertebrates. It is a viviparous species, retaining the eggs internally until they hatch. In the fiords of southern Chile, the young larvae occupy the channels where copepod eggs are plentiful while larger larvae move onto shelf areas where the salinity is higher and larger copepod prey is more abundant.[6]

References[edit]

  1. ^ a b c d e f Froese, Rainer and Pauly, Daniel, eds. (2007). "Sebastes capensis" in FishBase. February 2007 version.
  2. ^ a b Barrientos, Gonzalez and Moreno (2006). Geographical differences in the feeding patterns of red rockfish (Sebastes capensis) along South American coasts. Fishery Bulletin 104(4): 489-497
  3. ^ "Scorpaena capensis". Integrated Taxonomic Information System. Retrieved 26 February 2007. 
  4. ^ "Sebastichthys capensis". Integrated Taxonomic Information System. Retrieved 26 February 2007. 
  5. ^ "Sebastes chamaco". Integrated Taxonomic Information System. Retrieved 26 February 2007. 
  6. ^ a b Landaeta, M. F.; Castro, Leonardo R. (2006). "Larval distribution and growth of the rockfish, Sebastes capensis (Sebastidae, Pisces), in the fjords of southern Chile". ICES Journal of Marine Science 63: 714–724. doi:10.1016/j.icesjms.2006.01.002. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!