Overview

Comprehensive Description

Biology

A common inshore and offshore shark found on the continental shelf over rough, even rocky or coralline ground, and algal-covered bottoms. Found at depths of 1 or 2 m to at least 125 m. Feed on bottom-living invertebrates such as mollusks and crustaceans and on demersal fishes (e.g. sharks, S. canicula). Oviparous (Ref. 50449). Utilized fresh and dried salted for human consumption, and processed into fishmeal. May attain 170 cm (Ref. 27000).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 The nurse hound Scyliorhinus stellaris is a large catshark that can reach up to 1.6 m in length. It is slender but fairly stocky in build. It has two dorsal fins, located towards the rear half of the body. It has an anal fin unlike members of the dogfish family. Scyliorhinus stellaris is easily recognised by the large and small black spots (and sometimes white spots) on its creamy brown back. The underside is white.Unlike Scyliorhinus canicula it has only small anterior nasal flaps that do not reach the mouth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Northeast and eastern central Atlantic and Mediterranean Sea: distributed from the Shetland Isles and southern Norway in the north, to Senegal in the south. Records further south in the Atlantic, to Gulf of Guinea and Congo may be misidentifications of Scyliorhinus cervigoni. It is found throughout the Mediterranean Sea, but does not occur in the Black Sea. (Compagno et al. 2005, Notarbartolo and Bianchi 1998, Whitehead et al. 1984, Fischer et al. 1987, Bauchot 1987, Serena 2005).

In the Mediterranean, this species appears to be more abundant in the eastern central basin (the Adriatic and Ionian seas and Albanian coasts) compared to the western regions (Baino et al. 2001). This species was not caught in the trawl surveys conducted off the coasts of Morocco, Spain and France. However, it should be noted that the bottom trawl net is not the most appropriate gear for sampling this species. It is common on rocky bottoms or coralline grounds to 400 m of depth but more common between 20 and 150 m in the coastal areas of the continental platform (Bauchot 1987). The mating and nursery grounds as well as the extent of this species? movements throughout the Mediterranean are not known.

It also occurs in coastal and shallow shelf seas of the Northeast Atlantic, from the Shetland Isles and southern Norway in the north, to north-west Africa in the south. Around the British Isles, it is uncommon in the North Sea, and more common off southern and western coasts. Areas where it seems most abundant include parts of the English Channel and Bristol Channel, Cardigan Bay and around the Lleyn Peninsula and Anglesey (Ellis et al. 2005a). It tends to be most abundant on coarse and rocky inshore grounds, and such habitats tend to be under-represented in trawl surveys.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northeast Atlantic: Shetlands (rare), southern Scandinavia and British Isles to Morocco, including the Mediterranean. Distribution southward of this range is uncertain.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Sea, Mediterranean Sea, Eastern North Atlantic: Shetland Islands and southern Norway to Morocco.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Body shape lateral: elongated
Cross section: compressed
Type of eyes: more or less normal
Type of mouth/snout: more or less normal
Position of mouth: sub-terminal/inferior
Diagnosis: A large, fairly stocky, catshark with large and small black spots and sometimes white spots covering dorsal surface, saddle markings obsolete, small anterior nasal flaps that do not reach the mouth, no nasoral grooves, labial furrows on lower jaw only, second dorsal fin much smaller than first.
Lateral Lines: Interrupted: No
Gill clefts (sharks/rays only): 5
Fins number: 2
Finlets No.: Dorsal 0 – 0, Ventral 0 - 0
Spines total: 0 - 0
Soft-rays total: 0 - 0
Adipose fin: absent
Attributes: heterocercal

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1620 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

170 cm TL (male/unsexed; (Ref. 26999)); max. reported age: 19 years (Ref. 72467)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

A large, fairly stocky, catshark with large and small black spots and sometimes white spots covering dorsal surface, saddle markings obsolete, small anterior nasal flaps that do not reach the mouth, no nasoral grooves, labial furrows on lower jaw only, second dorsal fin much smaller than first (Ref. 244)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found at depths of 1?2 m to at least 125 m, but is commonest in depths of 20?63 m (Compagno in prep.) or 20?150 m with a maximum depth of 400 m (Bauchot 1987, Serena, 2005). Within the northern Tyrrhenian and southern Ligurian sea, S. stellaris is distributed from 55?409 m depth (Baino and Serena 2000). It often occurs on rough or even rocky bottom or surfaces with algal cover and in the Mediterranean it is apparently prefers coralline algal substrates (Compagno in prep.).

The maximum reported size for S. stellaris in the Mediterranean is 150 cm (TL), and with a common range of 40?55 cm (TL) (Bauchot 1987). Adults are common to 125 cm (Compagno in prep.). Males mature at 77 cm total length (TL) and females at 79 cm TL (Bauchot 1987).

This is an oviparous species, with a single egg laid at a time per oviduct (Compagno in prep.). The large thick-walled egg-cases (10-13cm long with strong tendrils at each corner) are deposited on algae in the subtidal or extreme lower intertidal zone in spring and summer (Compagno in prep.). Once the eggs are deposited they take up to nine months to hatch (Compagno in prep.) with hatchlings measuring 10?16 cm at birth (Tortonese 1956, Bauchot 1987, Compagno in prep.). Egg-cases are often laid on macro-algae in inshore areas (Ellis et al. 2005a).

The diet of S. stellaris mostly consists of crustaceans (including hermit crabs, swimming crabs, cancrid crabs and large shrimp), squid, octopi and other molluscs, a variety of bony fish (including mackerel, epigonids, dragonets, gurnards, flatfish, herring, small codfish and other demersal fishes) and other sharks (including Scyliorhinus canicula). Along the Tunisian coasts, S. stellaris is also reported to feed on cephalopods, teleosts and crustaceans (Capapé 1975). There was no seasonal variation observed in the diet of S. stellaris, however adults (both males and females) fed on more cephalopods and teleosts, and less crustaceans in comparison to that of juveniles (Capapé 1975, Ellis et al. 1996).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 400 m (Ref. 27000), usually 20 - 63 m (Ref. 244)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 142 specimens in 1 taxon.
Water temperature and chemistry ranges based on 54 samples.

Environmental ranges
  Depth range (m): 1 - 160
  Temperature range (°C): 8.316 - 19.273
  Nitrate (umol/L): 0.756 - 22.947
  Salinity (PPS): 34.250 - 37.656
  Oxygen (ml/l): 1.655 - 6.265
  Phosphate (umol/l): 0.115 - 1.554
  Silicate (umol/l): 2.210 - 11.058

Graphical representation

Depth range (m): 1 - 160

Temperature range (°C): 8.316 - 19.273

Nitrate (umol/L): 0.756 - 22.947

Salinity (PPS): 34.250 - 37.656

Oxygen (ml/l): 1.655 - 6.265

Phosphate (umol/l): 0.115 - 1.554

Silicate (umol/l): 2.210 - 11.058
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 The nurse hound occurs both inshore and offshore continental shelves, usually over rough and rocky or coralline grounds and seaweed beds, down to depths of up to 100 m. It can usually be found on or just above the seafloor.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 400m.
From 1 to 400 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, with a single egg per oviduct (Ref. 244). Embryos feed solely on yolk (Ref. 50449). Size at hatching about 16 cm (Ref. 244).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 19 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Evolution

Classification

Scyliorhinus stellaris (Linnaeus, 1758)
  • Wheeler, A. (1992). A list of the common and scientific names of fishes of the British Isles. J. Fish Biol. 41(Suppl. A): 1-37
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Scyliorhinus stellaris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCCAGTTATCTTTGGTGCATGAGCAGGCATGGTCGGAACAGCCCTAAGCCTACTAATTCGAGCTGAATTAGGTCAGCCGGGTTCACTTTTAGGTGATGATCAGATTTACAATGTAATCGTAACTGCCCATGCTTTCGTAATAATTTTCTTTATAGTTATACCAGTAATGATCGGTGGATTTGGAAACTGACTGGTACCCCTAATAATTGGAGCACCAGATATAGCCTTCCCTCGAATAAATAACATAAGCTTTTGACTCCTTCCACCCTCCTTTCTTCTCCTATTAGCCTCAGCAGGGGTAGAGGCCGGAGCAGGAACTGGGTGGACAGTTTATCCCCCATTAGCTGGTAATATAGCCCATGCCGGGGCATCCGTTGATTTAACTATCTTCTCCCTCCATCTAGCTGGTATTTCATCAATCTTAGCTTCAATTAATTTTATTACAACCATTATTAATATAAAACCCCCAGCCGTATCACAGTACCAAACACCCTTATTTGTGTGATCAATTCTCGTAACTACTGTCCTTCTTCTTTTATCCCTCCCTGTCCTTGCAGCCGGAATTACAATGTTATTAACAGATCGAAACCTTAATACAACATTCTTTGACCCAGCAGGAGGGGGAGACCCCATTCTTTATCAGCACTTATTCTGATTCTTTGGCCACCCAAAATTTCTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Scyliorhinus stellaris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Ellis, J., Serena, F., Mancusi, C., Haka, F., Morey, G., Guallart, J. & Schembri, T.

Reviewer/s
Dudley, S., Soldo, A., Francis, M. & Valenti, S.V. (Shark Red List Authority)

Contributor/s

Justification
The Nursehound (Scyliorhinus stellaris) is a large-bodied catshark that occurs inshore and offshore in the northeast and eastern central Atlantic, over the continental shelf between southern Scandinavia and Senegal, and is also present throughout the Mediterranean. It is found at depths of 1?2 m to at least 125 m, but is most common in depths of 20?63 m, and in relatively shallow waters in northern areas of the northeast Atlantic. Around the British Isles, it is locally abundant in certain areas (e.g., the coasts of Pembrokeshire, Anglesey, Lleyn Peninsula and Cardigan Bay), but may be at risk from localised depletion. This species is fished by bottom trawls, gill nets, bottom set long lines, handlines and fixed bottom nets, and occasionally pelagic trawls. Although limited data are available on the exploitation and trends in abundance, declines have been indicated in the Mediterranean Sea, particularly around the Balearic Islands and in the northwest Mediterranean. The capacity for recovery of this species is affected by a low level of interconnectivity between isolated populations around islands far from the continental coast. Little information is available on its biology, however, it is a large bodied species and is likely more vulnerable to population depletion than the Smallspotted Catshark (S. canicula), which also occurs in the region. Given its large size, patchy distribution and evidence for declines in areas of the Mediterranean Sea, an assessment of at least Near Threatened is warranted. There is concern that it may qualify for VU A4bd in the future.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Scyliorhinus stellaris is less abundant than S. canicula (Compagno in prep).

This species was reported in only 34 of 6336 (1%) tows conducted during the Mediterranean wide trawl (MEDITS) survey from 1994-1999 (Baino et al. 2001). Its overall biomass was estimated to be 0.6kg/km², with a higher presence in the eastern central Mediterranean area (Adriatic, Ionian sea and Albania: 1.2 kg/km²). The GRUND project (1985-1998), a series of experimental trawl surveys carried out on the continental and upper slopes of the central Mediterranean, reported 19.42% presence of this species in 22 surveys in Italian waters. Given percentage presence, this species was the 18th most common species, with the first and second most common species being Galeus melastomus and Scyliorhinus canicula (respectively 84.30% and 83.88% presence in trawls (Relini et al. 2000)).

No accurate data on population size is available for the Northeast Atlantic, although S. stellaris tends to be caught in low numbers only during trawl surveys. The population may be fragmented, as there are certain areas where they are most abundant. This species is rarely recorded in trawl surveys over finer sediments of the continental shelf, and tends to concentrate on coarse, inshore habitats. Around the British Isles, such areas occur along the coastline of Wales (Anglesey, Lleyn Peninsula, Cardigan Bay, Pembrokeshire, Gower), south-western England (Devon and Cornwall) and also off the French coast (Brittany).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Overfishing, together with habitat degradation, seem to be the major factors responsible for the decline of S. stellaris in the Mediterranean region. In addition, the capacity for population recovery of this species is affected by a low level of interconnectivity between isolated populations around islands far from the continental coast. The true extent of the impacts of fisheries on S. stellaris populations throughout the Mediterranean is difficult to evaluate, partly due to the lack of species-specific reports. In many areas, for example the Balearic Islands fishery and in Italian waters, S. stellaris is reported together with S. canicula or even as ?elasmobranchs?.

Taken as bycatch of the semi-industrial fisheries of Spain, the Adriatic Sea, Sicily and Cyprus and also in artisanal fisheries elsewhere and is regularly present in fish markets in Malta, Tunisia, Greece, Cyprus and Turkey (Compagno in prep.). In European waters, S. stellaris is less important as a fisheries species than S. canicula, but is regularly taken in bottom trawls, gill nets, bottom set long lines, handlines and fixed bottom nets, and occasionally pelagic trawls (Bauchot 1987, Compagno in prep.).

Benthic trawl effort has increased both numerically and in technological terms in the shelf and slope area of the Mediterranean over the last 50 years. For example, effort in trawl fisheries in the Gulf of Lions (NW Mediterranean) evolved from a small low powered fleet (total nominal horse power of 2, 700), increasing to a total nominal horse power of 19,940 hp (1974?1987). In a study of the long-term changes in groundfish diversity in the Gulf of Lions, Aldebert (1997) reports that there was a clear decrease in the abundance of this species since 1970. It was present in catches from the late 1950s to the 1980s and then disappeared from the catches after 1988 Aldebert (1997). Although not abundant, it seems that S. stellaris stocks have decreased in the Mediterranean.

A decline also seems to have occurred around Albania and the Balearic Islands: S. stellaris was frequently caught as bycatch by the bottom long-line and lobster fisheries, but catch numbers have decreased despite no change in the lobster fishing effort and equipment (G. Morey pers. obs.). Also of some concern is that the Balearic population has little connection with other populations of S. stellaris due the species? limited dispersal capacity. In the Balearic Islands S. stellaris was monitored from 131 hauls made between 40?1,800 m depth from 1996?2001 (Massutí and Moranta 2003), and while Galeus melastomus and S. canicula showed the highest abundances of all the elasmobranch species, S. stellaris was absent. Additionally, no specimens of S. stellaris have been captured during 12 trammel net surveys carried out in the Balearic Islands between 2000 and 2003 (Morey et al. in press). Current captures for this species in the Balearic Islands are sporadic. Fishermen report the species as common about 15 years ago, and abundant in lobster gillnet fishery, but becoming very rare to date (G. Morey pers. obs.). Jardas (1984) classified the species as rare in the western half of the Adriatic Sea in 1984, although S. stellaris does appear in trawl surveys carried out in 1948 and 1998 (Jukic-Peladic et al. 2001).

In the northeast Atlantic abundance data are insufficient to ascertain the current status, though due to its large size and patchy distribution, it may be at risk of localised depletion.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is protected in six marine reserves around the Balearic Islands, but further monitoring and protection measures are encouraged throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: public aquariums; price category: medium; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Nursehound

The nursehound (Scyliorhinus stellaris), also known as the large-spotted dogfish, greater spotted dogfish, or bull huss, is a species of catshark, family Scyliorhinidae, found in the northeastern Atlantic Ocean. It is generally found amongst rocks or algae at a depth of 20–60 m (66–200 ft). Growing up to 1.6 m (5.2 ft) long, the nursehound has a robust body with a broad, rounded head and two dorsal fins placed far back. It shares its range with the more common and closely related small-spotted catshark (S. canicula), which it resembles in appearance but can be distinguished from in having larger spots and nasal skin flaps that do not extend to the mouth.

Nursehounds have nocturnal habits and generally hide inside small holes during the day, often associating with other members of its species. A benthic predator, it feeds on a range of bony fishes, smaller sharks, crustaceans, and cephalopods. Like other catsharks, the nursehound is oviparous in reproduction. Females deposit large, thick-walled egg cases, two at a time, from March to October, securing them to bunches of seaweed. The eggs take 7–12 months to hatch. Nursehounds are marketed as food in several European countries under various names, including "flake", "catfish", "rock eel", and "rock salmon". It was once also valued for its rough skin (called "rubskin"), which was used as an abrasive. The International Union for Conservation of Nature (IUCN) has assessed the nursehound as Near Threatened, as its population in the Mediterranean Sea seems to have declined substantially from overfishing.

Taxonomy[edit]

Early illustration of a nursehound from Les poissons (1877).

The first scientific description of the nursehound was published by Carl Linnaeus, in the 1758 tenth edition of Systema Naturae. He gave it the name Squalus stellaris, the specific epithet stellaris being Latin for "starry". No type specimen was designated. In 1973, Stewart Springer moved this species to the genus Scyliorhinus.[2][3] The common name "nursehound" came from an old belief by English fishermen that this shark attends to its smaller relatives, while the name "huss" may have come from a distortion of the word "nurse" over time.[4]

Distribution and habitat[edit]

The nursehound is found in the northeastern Atlantic from southern Norway and Sweden to Senegal, including off the British Isles, throughout the Mediterranean Sea, and the Canary Islands. It may occur as far south as the mouth of the Congo River, though these West African records may represent misidentifications of the West African catshark (S. cervigoni).[5] Its range seems to be rather patchy, particularly around offshore islands, where there are small local populations with limited exchange between them.[1] The nursehound can be found from the intertidal zone to a depth of 400 m (1,300 ft), though it is most common between 20 m (66 ft) and 60–125 m (200–410 ft).[1] This bottom-dwelling species prefers quiet water over rough or rocky terrain, including sites with algal cover. In the Mediterranean, it favors algae-covered coral.[2][6]

Description[edit]

Photo of a nursehound with crosswise dark bands, swimming over a strip from a fishing net
Young nursehounds have prominent saddle markings.

The nursehound attains a length of 1.6 m (5.2 ft), though most measure less than 1.3 m (4.3 ft).[2] This shark has a broad, rounded head and a stout body that tapers towards the tail. The eyes are oval in shape, with a thick fold of skin on the lower rim but no nictitating membrane. Unlike in the small-spotted catshark, the large flaps of skin beside the nares do not reach the mouth.[6] In the upper jaw, there are 22–27 tooth rows on either side and 0–2 teeth at the symphysis (center); in the lower jaw, there are 18–21 tooth rows on either side and 2–4 teeth at the symphysis. The teeth are Y-shaped and smooth-edged; the anterior teeth have a single central cusp, while the posterior teeth have an additional pair of lateral cusplets. Towards the rear of the jaws, the teeth become progressively smaller and more angled, with proportionately larger lateral cusplets.[7] The five pairs of gill slits are small, with the last two over the pectoral fin bases.[6]

The two dorsal fins are placed far back on the body; the first is larger than the second and originates over the bases of the pelvic fins. The pectoral fins are large. In males, the inner margins of the pelvic fins are merged into an "apron" over the claspers. The caudal fin is broad and nearly horizontal, with an indistinct lower lobe. The skin is very rough, due to a covering of large, upright dermal denticles.[2] The nursehound has small black dots covering its back and sides, interspersed with brown spots of varying shapes larger than the pupil, on a grayish or brownish background. The pattern is highly variable across individuals and ages; there may also be white spots, or the brown spots may be expanded so that almost the whole body is dark, or a series of faint "saddles" may be present. The underside is plain white.[5][6]

Biology and ecology[edit]

Primarily nocturnal, nursehounds spend the day inside small holes in rocks and swim into deeper water at night to hunt. Sometimes two sharks will squeeze into the same hole, and several individuals will seek out refuges within the same local area. In one tracking study, a single immature nursehound was observed to use five different refuges in succession over a period of 168 days, consistently returning to each one over a number of days before moving on. Nursehounds may occupy refuges to hide from predators, avoid harassment by mature conspecifics, and/or to facilitate thermoregulation.[8] In captivity, these sharks are gregarious and tend to rest in groups, though the individuals comprising any particular group changes frequently.[9] This species is less common than the small-spotted catshark.[6]

The nursehound feeds on a variety of benthic organisms, including bony fishes such mackerel, deepwater cardinalfishes, dragonets, gurnards, flatfishes, and herring, and smaller sharks such as the small-spotted catshark. It also consumes crustaceans, in particular crabs but also hermit crabs and large shrimp, and cephalopods.[2][10] Given the opportunity, this shark will scavenge.[6] Adults consume relatively more bony fish and cephalopods, and fewer crustaceans, than juveniles.[1] Known parasites of this species include the monogeneans Hexabothrium appendiculatum and Leptocotyle major,[11][12] the tapeworm Acanthobothrium coronatum,[13] the trypanosome Trypanosoma scyllii,[14] the isopod Ceratothoa oxyrrhynchaena,[15] and the copepod Lernaeopoda galei.[16] The netted dog whelk (Nassarius reticulatus) preys on the nursehound's eggs by piercing the case and extracting the yolk.[17]

Life history[edit]

Nursehound egg capsules, some with their cases cut open to show the embryos inside.

Like other members of its family, the nursehound is oviparous. Known breeding grounds include the River Fal estuary and Wembury Bay in England,[17] and a number of coastal sites around the Italian Peninsula, in particular the Santa Croce Bank in the Gulf of Naples.[18] Adults move into shallow water in the spring or early summer, and mate only at night.[19] The eggs are deposited in the shallows from March to October.[10] Although a single female produces 77–109 oocytes per year, not all of these are ovulated and estimates of the actual number of eggs laid range from 9 to 41.[19] The eggs mature and are released two at a time, one from each oviduct.[2] Each egg is enclosed in a thick, dark brown case measuring 10–13 cm (3.9–5.1 in) long and 3.5 cm (1.4 in) wide. There are tendrils at the four corners, that allow the female to secure the egg cases to bunches of seaweed (usually Cystoseira spp. or Laminaria saccharina).[17]

Eggs in the North Sea and the Atlantic take 10–12 months to hatch, while those from the southern Mediterranean take 7 months to hatch. The length at hatching is 16 cm (6.3 in) off Britain, and 10–12 cm (3.9–4.7 in) off France. Newly hatched sharks grow at a rate of 0.45–0.56 mm (0.018–0.022 in) per day, and have prominent saddle markings. Sexual maturity is attained at a length of 77–79 cm (30–31 in), which corresponds to an age of four years if hatchling growth rates remain constant.[10][19] This species has a lifespan of at least 19 years.[20]

Human interactions[edit]

photo of a nursehound in a public aquarium
A nursehound in a public aquarium; this species adapts well to captivity.

Nursehounds are generally harmless to humans.[21] However, 19th-century British naturalist Jonathan Couch noted that "although not so formidable with its teeth as many other sharks, this fish is well able to defend itself from an enemy. When seized it throws its body round the arm that holds it, and by a contractile and reversed action of its body grates over the surface of its enemy with the rugged spines of its skin, like a rasp. There are few animals that can bear so severe an infliction, by which their surface is torn with lacerated wounds."[22] This shark is displayed by many public aquariums and has been bred in captivity.[9]

The rough skin (called "rubskin") of the nursehound was once used to polish wood and alabaster, to smooth arrows and barrels, and to raise the hairs of beaver hats as a replacement for pumice. Rubskin was so valued that a pound of it was worth a hundredweight of sandpaper.[23][24] The liver was also used as a source of oil, and the carcasses cut up and used to bait crab traps.[23] The meat of this species is marketed fresh or dried and salted, though it is considered "coarse" in some quarters.[21][23] In the United Kingdom (UK), it is one of the species sold under the names "flake", "catfish", "rock eel", or "rock salmon".[4][25] In France, it is sold as grande rousette or saumonette, as after being skinned and beheaded it resembles salmon.[26] This species is also sometimes processed into fishmeal, or its fins dried and exported to the Asian market. In European waters, commercial production of this species is led by France, followed by the UK and Portugal; it is caught using bottom trawls, gillnets, bottom set longlines, handlines and fixed bottom nets. In 2004, a total catch of 208 tons was reported from the northeastern Atlantic.[1][2][27]

The impact of fishing activities on the nursehound is difficult to assess as species-specific data is generally lacking. This species is more susceptible to overfishing than the small-spotted catshark because of its larger size and fragmented distribution, which limits the recovery potential of depleted local stocks. There is evidence that its numbers have declined significantly in the Gulf of Lion, off Albania, and around the Balearic Islands.[1] In the upper Tyrrhenian Sea, its numbers have fallen by over 99% since the 1970s.[28] These declines have led the International Union for Conservation of Nature (IUCN) to list the nursehound under Near Threatened.[1]

References[edit]

  1. ^ a b c d e f g Ellis, J., F. Serena, C. Mancusi, F. Haka, G. Morey, J. Guallart, and T. Schembri (2006). "Scyliorhinus stellaris". IUCN Red List of Threatened Species. Version 2010.2. International Union for Conservation of Nature. Retrieved October 3, 2010. 
  2. ^ a b c d e f g Compagno, L.J.V. (1984). Sharks of the World: An Annotated and Illustrated Catalogue of Shark Species Known to Date. Rome: Food and Agricultural Organization. pp. 366–367. ISBN 92-5-101384-5. 
  3. ^ Squalus stellaris. (2007). Catalog of Fishes. California Academy of Sciences. Retrieved on July 24, 2009.
  4. ^ a b Davidson, A. (2002). Mediterranean Seafood: A Comprehensive Guide with Recipes (third ed.). Ten Speed Press. p. 28. ISBN 1-58008-451-6. 
  5. ^ a b Compagno, L.J.V., Dando, M. and Fowler, S. (2005). Sharks of the World. Princeton University Press. p. 252. ISBN 978-0-691-12072-0. 
  6. ^ a b c d e f Lythgoe, J. and Lythgoe, G. (1992). Fishes of the Sea: The North Atlantic and Mediterranean. MIT Press. p. 21. ISBN 0-262-12162-X. 
  7. ^ Soldo, A., Dulcic, J. and Cetinic, P. (2000). "Contribution to the study of the morphology of the teeth of the nursehound Scyliorhinus stellaris (Chondrichthyes: Scyliorhinidae)". Scientia Marina 64 (3): 355–356. 
  8. ^ Sims, D.W., Southall, E.J., Wearmouth, V.J., Hutchinson, N., Budd, G.C. and Morritt, D. (2005). "Refuging behaviour in the nursehound Scyliorhinus stellaris (Chondrichthyes: Elasmobranchii): preliminary evidence from acoustic telemetry". Journal of the Marine Biological Association of the United Kingdom 85 (5): 1137–1140. doi:10.1017/S0025315405012191. 
  9. ^ a b Scott, G.W., Gibbs, K. and Holding, J. (1997). "Group 'resting' behaviour in a population of captive bull huss (Scyliorhinus stellaris)". Aquarium Sciences and Conservation 1: 251–254. 
  10. ^ a b c Ford, E. (1921). "A contribution to our knowledge of the life-histories of the dogfishes landed at Plymouth". Journal of the Marine Biological Association of the United Kingdom 12 (3): 468–505. doi:10.1017/S0025315400006317. 
  11. ^ Kearn, G.C. (2004). Leeches, Lice and Lampreys: A Natural History of Skin and Gill Parasites of Fishes. Springer. p. 104. ISBN 1-4020-2925-X. 
  12. ^ Llewellyn, J., Green, J.E. and Kearn, G.C. (1984). "A check-list of monogenean (Platyhelminth) parasites of Plymouth hosts". Journal of the Marine Biological Association of the United Kingdom 64 (4): 881–887. doi:10.1017/S0025315400047299. 
  13. ^ Williams, H.H. and Jones, A. (1994). Parasitic Worms of Fish. CRC Press. p. 336. ISBN 0-85066-425-X. 
  14. ^ Pulsford, A. (1983). "Preliminary studies on trypanospmes from the dogfish, Scyliorhinus canicula L". Journal of Fish Biology 24 (6): 671–682. doi:10.1111/j.1095-8649.1984.tb04838.x. 
  15. ^ Ramdane, Z., Bensouilah, M.A. and Trilles, J.P. (2007). "The Cymothoidae (Crustacea, Isopoda), parasites on marine fishes, from Algerian fauna". Belgian Journal of Zoology 137 (1): 67–74. 
  16. ^ Karaytug, S., Sak, S. and Alper, A. (2004). "Parasitic Copepod Lernaeopoda galei Krøyer, 1837 (Copepoda: Siphonostomatoida): A First Record from Turkish Seas". Turkish Journal of Zoology 28: 123–128. 
  17. ^ a b c Orton, J.H. (1926). "A Breeding Ground of the Nursehound (Scyliorhinus stellaris) in the Fal Estuary". Nature 118 (2977): 732. doi:10.1038/118732a0. 
  18. ^ de Sabata, S.; Clò, S. (2013). "Some breeding sites of the nursehound (Scyiorhinus stellaris) in Italian waters as reported by divers". Biologia Marina Mediterranea 20 (1): 178–179. 
  19. ^ a b c Capapé, C., Vergne, Y., Vianet, R., Guélorget, O. and Quignard, J. (2006). "Biological observations on the nursehound, Scyliorhinus stellaris (Linnaeus, 1758) (Chondrichthyes: Scyliorhinidae) in captivity". Acta Adriatica 47 (1): 29–36. 
  20. ^ Longevity, ageing, and life history of Scyliorhinus stellaris. AnAge: The Animal Ageing and Longevity Database. Retrieved on July 17, 2009.
  21. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2009). "Scyliorhinus stellaris" in FishBase. July 2009 version.
  22. ^ Couch, J. (1868). A History of the Fishes of the British Islands. Groombridge and Sons. p. 11–12. 
  23. ^ a b c Day, F. (1884). The Fishes of Great Britain and Ireland. Williams and Norgate. pp. 312–313. 
  24. ^ Yaxley, D. (2003). A Researcher's Glossary of Words Found in Historical Documents of East Anglia. Larks Press. p. 107. ISBN 1-904006-13-2. 
  25. ^ Davidson, A. (2004). North Atlantic Seafood: A Comprehensive Guide with Recipes (third ed.). Ten Speed Press. p. 168. ISBN 1-58008-450-8. 
  26. ^ Vannuccini, S. (1999). Shark Utilization, Marketing and Trade. Food and Agriculture Organization of the United Nations. pp. 175–176. ISBN 92-5-104361-2. 
  27. ^ FAO Yearbook [of] Fishery Statistics: Aquaculture Production, 2004. Food and Agriculture Organization. 2006. p. 436. ISBN 92-5-005519-6. 
  28. ^ Ferretti, F., Myers, R.A., Sartor, P. and Serena, F. (2005). Long Term Dynamics of the Chondrichthyan Fish Community in the Upper Tyrrhenian Sea. ICES Council Meeting, 2005/N:25. Retrieved on July 15, 2009.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!