Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Lesser spotted dogfish are small bottom sharks and are harmless for man. Sometimes you find the empty olive-colored egg cases along the flood mark on the beach. These egg cases are also called mermaid's purses. You can usually see a tear where the young shark left the egg. The tips of the cases were once attached to a stone, shipwreck or maybe even seaweed. It is very unusual to find a case that still contains life. That is easy to check, since the egg capsule is transparent.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

Dogfish are small, shallow-water sharks with blunt heads and slender, elongate bodies and two dorsal fins situated towards the tail end of the body. The dogfish is the most common shark encountered by divers. It is usually between 60-70cm in length although it can be up to 1m. The upper surface is greyish to pale brown with small dark brown spots, the underside is creamy-white. The skin is rough, similar to the texture of sand paper. The common dogfish is easily confused with the nursehound (Scylorhinus stellaris) however the two species can usually be distinguished by their coloration. The former has numerous small dark spots whilst the latter has fewer and larger dark spots. They can also be distinguished by their nasal grooves which are connected to the mouth in the dogfish but are unconnected in the nursehound.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Biology

Most common catshark in coastal waters of Europe (Ref. 32804). Inhabits continental shelves and uppermost slopes. Found on sandy, coralline, algal, gravel or muddy bottoms. Occurs mainly between 10-100 m depth in the northeast Atlantic and up to 400 m depth in the Mediterranean Sea (Ref. 88187) and from 288-780 m in the eastern Ionian Sea (Ref. 56504). They sometimes occur in midwater. Nocturnal species, males resting on substrate and females hiding in shallow (0.5-1.5 m depth) caves and crevices during the day (Ref. 88835). Feed on a variety of benthic invertebrates, including mollusks, crustaceans, small cephalopods, polychaete worms, and small bony fishes (Ref. 244, 11889). Males have been found to forage in shallow prey-rich areas with soft sediment or areas covered with filamentous algae (Ref. 88836). Oviparous, with a single egg laid per oviduct at a time. Detect weak electric fields generated by other organisms (e.g. potential prey) (Ref. 10311). Utilized fresh and dried-salted for human consumption, also for oil and fishmeal.
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 2 - Carcharhiniformes. FAO Fish. Synop. 125(4/2):251-655. Rome: FAO. (Ref. 244)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Scyliorhinus canicula (Linnaeus, 1758)

Sea of Marmara : 500-4 (1 spc.), 05.07.1991 , Offshore of Guerpinar , 250 m , N. Meriç . Aegean Sea : 500-71 (1 spc.), 07.06.2001 , Bozcaada Island , trammel net , 5 m, L. Eryilmaz .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 31-31, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

 This small shark has a slender shark-shaped body with a blunt head, rounded snout and small dorsal fin. The nostrils are located on the underside of the snout and are connected to the mouth by a curved groove. There are five pairs gill slits, the last two of which overlap the pectoral fins. The upper side is greyish-brown with darker spots and the underside is a lighter greyish-white colour.Also known as dog fish, rough hound and rock salmon. Eggs are known as 'mermaid's purses'. Numbers fluctuate annually possibly due to fishing activity.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Widespread in the northeast and eastern central Atlantic from the Shetland Islands and Norway in the north, to western Africa (Morocco, Western Sahara and Mauritania to Senegal, possibly along the Ivory Coast) in the south, including the Mediterranean Sea (Compagno et al. 2005). It does not occur in the Black Sea, although there may be occasional records of this species as a vagrant (Compagno et al. 2005).

Northeast Atlantic
Though there is some spawning in shallow sublittoral habitats, where the eggs are laid on macroalgae, spawning also occurs further offshore on grounds with biogenic fauna (e.g., sponges, hydroids and bryozoans), such as the northern Bristol Channel, around the south and west coasts of Ireland and in the Irish sea loughs (Ellis and Shackley 1997, Sims 2003, Ellis et al. 2005a).

Mediterranean
Data from the Mediterranean International Trawl Survey (MEDITS) programme indicates that this species occurs extensively throughout the northern Mediterranean Sea (Baino et al. 2001). These surveys were carried out from the Alboran (western Mediterranean) to the Aegean Sea (eastern Mediterranean), between April and June, from 1994 to 1999. Across the 40 different survey subsectors and depth strata, S. canicula was caught everywhere with the exception of the northern and southwestern Adriatic Sea, northwestern and northern Ionian Sea and off eastern Sicily. Concentrations of juveniles are located on the upper slopes (~200 m), in particular around northeastern Corsica and northeastern Sardinia, which may be nursery grounds. Nursery grounds may also be found off Livorno, Tuscany (Baino and Serena 2000). The highest numbers of juveniles were found on the edge of the shelf off western Morocco. Length frequency distribution (LFD) data provided by Baino et al. (2001), in combination with other studies (D'onghia et al. 1995 and Relini et al. 1999), suggest that nursery areas are located on the seabed at depths of about 200 m. The species appears to segregate with size (Baino and Serena 2000).They move into coastal waters as they mature, and mature adults then return back to the shelf edge for reproduction.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northeast Atlantic: Norway and British Isles south to Senegal, including the Mediterranean. Possibly Côte d'Ivoire. Some populational differences exist between Catulus duhameli (a name for the Mediterranean canicula based on size) and this species which may eventually be expressed as subspecies. The only reported observation of this species in Crimean waters was in 1937, which is possibly erroneous (Ref. 897).
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 2 - Carcharhiniformes. FAO Fish. Synop. 125(4/2):251-655. Rome: FAO. (Ref. 244)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Baltic Sea, North Sea, Mediterranean Sea, Black Sea, eastern North Atlantic: Shetland Islands and southern Norway to Senegal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species is common and widespread all around the coasts of Britain and Ireland.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 2 - Carcharhiniformes. FAO Fish. Synop. 125(4/2):251-655. Rome: FAO. (Ref. 244)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

100.0 cm TL (male/unsexed; (Ref. 244)); max. published weight: 1,320 g (Ref. 40637); max. reported age: 12 years (Ref. 81067)
  • IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA. (Ref. 40637)
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 2 - Carcharhiniformes. FAO Fish. Synop. 125(4/2):251-655. Rome: FAO. (Ref. 244)
  • Ivory, P., F. Jeal and C.P. Nolan 2005 Age determination, growth and reproduction in the lesser-spotted dogfish, Scyliorhinus canicula (L.). J. Northw. Atl. Fish. Sci. 35:89-106. (Ref. 81067)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

A slender, dark-spotted catshark with 8-9 dusky saddles (often obscure or absent), greatly expanded anterior nasal flaps, reaching mouth and covering shallow nasoral grooves, labial furrows on lower jaw only, first dorsal fin originates well behind the pelvic fins, second dorsal fin much smaller than first (Ref. 244).
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 2 - Carcharhiniformes. FAO Fish. Synop. 125(4/2):251-655. Rome: FAO. (Ref. 244)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is a small, temperate, bottom-dwelling catshark is found o from the shallow sub-littoral to the edge of the continental shelf to depths of at least 300 m in the north (Ellis et al. 2005), and occur deeper further south and in the Mediterranean Sea. Around the British Isles they are more common in waters <150 m deep. The species is widespread and abundant on a variety of substrates (sandy, coralline algal, gravelly or muddy bottoms). They are known to aggregate by sex and size, though it is unclear whether this sexual segregation is behavioural or habitat-linked. Within loughs, females exhibit strong philopatric behaviour to refuging sites, while males are wider ranging and less philopatric (Sims 2003). However, studies on the wider continental shelf are lacking.

S. canicula is an oviparous species that deposits egg-cases protected by a horny capsule with long tendrils. These egg-cases are often deposited on macroalgae (e.g., Fucus, Laminaria and Himanthalia) in shallow coastal waters (Wheeler 1978, Compagno 1984, Capapé et al. 1991). Further from shore, egg-cases are deposited on sessile erect invertebrates, including sponges, hydroids, soft corals and bryozoans (Ellis and Shackley 1997, Rodriguez-Cabello et al. 1998). Extrapolating egg-laying rates in captive specimens to a whole year provides an estimated fecundity of 29-62 eggs/year for Northeast Atlantic populations (Ellis and Shackley 1997). Capapé (1977) and Capapé et al. (1991) estimated annual fecundity at 96-115 and 45-190 respectively for Mediterranean populations. Fischer et al. (1987) estimated that females can deposit up to 100 eggs per year. Fecundity increases with maternal size (Capapé 1977, Ellis and Shackley 1997, Henderson and Casey 2001).

Spawning can take place almost all year round (Capapé 1977, Capapé et al. 1991, Ellis and Shackley 1997), although there are seasonal patterns in spawning activity. In the northeast Atlantic, S. canicula has an annual cycle with a protracted 10-11 month breeding season (Ellis and Shackley 1997) In the Mediterranean Seathey breed annually from November to July, or possibly all year round (Capapé 1977).

Gestation lasts approximately 5-11 months (usually eight to nine months), depending on ambient water temperature, and the sex ratio of recently hatched fish is about 1:1 (Ellis and Shackley 1997). In the Northeast Atlantic, the gestation period has been estimated at five to six months (Ellis and Shackley 1997). Size at birth is 7-11 cm total length (TL) (Springer 1979, Ellis and Shackley 1997).

Size at maturity is reportedly 35 to 47 cm total length (TL) for females and 30-44 cm for males (Capapé 1977, Jardas 1979, Ungaro et al. 2002, Capapé et al. 2000). In the Northeast Atlantic, females reach maturity at 52-65 cm TL, and males at 49-55 cm TL (Ellis and Shackley 1997). Maximum size is reported at 80 cm TL by Ellis et al. (2005b) and Relini (1999), and at 100 cm by Compagno et al. (2005). The species generally appears to grow to a larger size in the Atlantic than the Mediterranean (Compagno et al. 2005).

They feed on a variety of invertebrates (including polychaetes, crustaceans and molluscs) and fishes (Ellis et al. 1996).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found on sandy, coralline, algal, gravel or muddy bottoms at depths of a few meters commonly down to 110 m.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 10 - 780 m (Ref. 56504), usually 80 - 100 m (Ref. 81056)
  • Mytilineou, C., C.-Y. Politou, C. Papaconstantinou, S. Kavadas, G. D'Onghia and L. Sion 2005 Deep-water fish fauna in the Eastern Ionian Sea. Belg. J. Zool., 135(2):229-233. (Ref. 56504)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 80582 specimens in 1 taxon.
Water temperature and chemistry ranges based on 43107 samples.

Environmental ranges
  Depth range (m): -9 - 920
  Temperature range (°C): 6.695 - 19.273
  Nitrate (umol/L): 0.756 - 17.264
  Salinity (PPS): 32.748 - 38.739
  Oxygen (ml/l): 3.476 - 6.588
  Phosphate (umol/l): 0.098 - 1.070
  Silicate (umol/l): 1.720 - 9.625

Graphical representation

Depth range (m): -9 - 920

Temperature range (°C): 6.695 - 19.273

Nitrate (umol/L): 0.756 - 17.264

Salinity (PPS): 32.748 - 38.739

Oxygen (ml/l): 3.476 - 6.588

Phosphate (umol/l): 0.098 - 1.070

Silicate (umol/l): 1.720 - 9.625
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Scyliorhinus canicula lives particularly in the shallow sublittoral on muddy and sandy substrata to a depth of 100 m. It may also be found in rocky areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 400m.
Recorded at 400 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dogfish are bottom-living sharks which occur on a wide variety of seabed types but are most commonly encountered on sand or gravel at depths between 1-50m, although it is occasionally recorded from much greater depths. It feeds on a range of bottom-living invertebrates, especially crabs, shrimps, molluscs and worms and also some small fish.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Experiments in southwest Ireland showed that male individuals move from deeper water (12-24 m) during the day, to adjacent shallow feeding areas at dusk (
  • Wetherbee, B.M., S.H. Gruber and E. Cortes 1990 Diet, feeding habits, digestion, and consumption in sharks, with special reference to the lemon shark, Negaprion brevirostris. p. 29-47. In H.L. Pratt, Jr., S.H. Gruber and T. Taniuchi (eds.) Elasmobranchs as living resources: advances in the biology, ecology, systematics, and the status of the fisheries. NOAA Tech. Rep. NMFS 90. 517 p. (Ref. 568)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on molluscs and crustaceans, small cephalopods, polychaete worms, and small bony fishes
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Oviparous, laying paired eggs (one per oviduct) in shallow subtidal areas, although some egg cases have been found in the deeper part of intertidal zones (Ref. 244). Embryos feed solely on yolk (Ref. 50449). The egg cases are anchored to macroalgae, sea grass or sessile erect invertebrates such as poriferans, bryozoans and hydroids (Ref. 32804, 58137). The capsules have tendrils at each corner used for anchorage purposes. Egg capsule size varies according to locality and female size (Ref. 244) and ranges between 4.9-7.0 cm length and 1.5-3.0 cm width (Ref. 88837). Egg cases may be deposited throughout the year, peaking in June and July (Ref. 32804). Recent studies estimate fecundity of females from the northeast Atlantic to be at around 29-62 pups (Ref. 32804). Fully formed pups hatch after 5-11 months, depending on water temperature (Ref. 244, 32804). Newly hatched pups are about 8-10 cm in length (Ref. 78469).
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 2 - Carcharhiniformes. FAO Fish. Synop. 125(4/2):251-655. Rome: FAO. (Ref. 244)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 12 years (wild) Observations: Estimates of age at sexual maturity range from 3 (http://www.fishbase.org/) to almost 8 years (Garcia et al. 2008).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Evolution

Classification

Scyliorhinus canicula (Linnaeus, 1758)
  • Wheeler, A. (1992). A list of the common and scientific names of fishes of the British Isles. J. Fish Biol. 41(Suppl. A): 1-37
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Scyliorhinus canicula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 24 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGTTGACTCTTTTCTACTAACCACAAAGACATCGGCACCCTTTACTTAATCTTTGGTGCATGAGCAGGCATAGTCGGAACAGCCCTAAGCCTCCTAATTCGAGCTGAGTTAGGTCAGCCGGGTTCACTTTTAGGGGAT---GATCAGATTTATAATGTAATCGTAACTGCCCATGCTTTCGTAATAATCTTCTTTATAGTTATGCCAGTAATAATTGGCGGATTTGGGAACTGACTAGTACCCCTAATGATTGGAGCACCAGATATAGCCTTCCCTCGAATAAATAACATAAGCTTCTGACTCCTTCCACCCTCCTTTCTCCTCCTATTAGCTTCAGCGGGGGTAGAAGCTGGGGCAGGGACTGGATGAACAGTCTATCCCCCATTAGCTGGTAATATAGCTCATGCGGGACGATCCGTTGATTTAACTATCTTCTCTCTCCACCTAGCTGGTATTTCATCAATTTTAGCTTCAATTAATTTTATCACAACTATTATTAATATAAAACCCCCAGCTGTATCACAATACCAAACACCATTATTTGTGTGATCAATTCTCGTGACTACCGTCCTTCTTCTTCTATCCCTCCCTGTCCTTGCAGCCGGAATTACAATATTGTTAACAGATCGAAATCTTAATACAACATTCTTTGACCCAGCAGGAGGAGGAGATCCTATTCTTTATCAGCACTTATTCTGATTCTTTGGTCACCCAGAAGTCTATATTTTAATTTTACCAGGTTTCGGTATAATTTCCCATGTAGTAGCCTACTATTCAGGTAAAAAAGAGCCCTTTGGGTATATAGGAATAGTATGAGCAATAATAGCAATCGGCCTACTTGGTTTTATTGTTTGAGCCCACCACATATTTACAGTAGGAATAGACGTAGACACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Scyliorhinus canicula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 43
Specimens with Barcodes: 113
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Ellis, J., Mancusi, C., Serena, F., Haka, F., Guallart, J., Ungaro, N., Coelho, R., Schembri, T. & MacKenzie, K.

Reviewer/s
Dudley, S., Soldo, A., Francis, M. & Valenti, S.V. (Shark Red List Authority)

Contributor/s

Justification
A small, common catshark, widespread in the Northeast and Eastern Central Atlantic, from Norway and the Shetland Islands to Senegal (possibly along the Ivory Coast), and found throughout the Mediterranean Sea. This is one of the most abundant elasmobranchs in the Northeast Atlantic and Mediterranean Sea. Although localized depletions appear to have occurred in some areas (e.g., in the Wadden Sea and off Malta), scientific surveys throughout the majority of its range suggest that populations are stable or even increasing in some areas. Reproduction is oviparous and the species appears to be relatively productive biologically, thus may be able to withstand higher levels of exploitation. Though commercial landings are made and large individuals are retained for human consumption, the species is often discarded and studies show that post-discard survival rates are high. The species is assessed as Least Concern because overall population trends appear to be stable and there is no evidence to indicate that the global population has declined significantly. Catches and population trends should be monitored.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Common throughout its range. This species is one of the most abundant elasmobranchs within the Northeast Atlantic and Mediterranean Sea.

Northeast Atlantic
The EU-funded Development of Elasmobranch Assessments project (DELASS) concluded that S. canicula would be best assessed as forming local populations (e.g., on the level of an ICES division) because of the limited movements and migrations of the species and its oviparous nature, assuming that immigration and emigration from adjacent populations are either insignificant or on a par (Heessen 2003). Survey trends in most shelf seas (including the North Sea, northwest Scotland, Irish Sea, English Channel, Celtic Sea and Cantabrian Sea) seem stable (Heessen 2003, MacKenzie 2004, Ellis et al. 2005b, ICES 2007). There may be many separate sub-populations of this species, due to its lack of migration between different areas, e.g. Hebrides and west coast of Scotland, southern North Sea and English Channel. Stocks around northern Scotland, particularly the Shetlands and the Hebrides, may be increasing in size (MacKenzie 2004).

Mediterranean
Data from the MEDITS trawl surveys indicates that this species is common in the Mediterranean (Baino et al. 2001). It had a high frequency of occurrence (28% of trawls) and high abundance in these trawl surveys, being particularly abundant in the Gulf of Lions and the Catalan and Aegean Seas. Maximum biomass indices were reported off northeast Corsica between 50 and 100 m depth (340 kg/km²) (Baino et al. 2001). Juveniles made up the main proportion of the population (78% of total population) sampled (Baino et al. 2001). Comparison between trawl surveys in 1948 and 1998 showed no significant differences in distribution and abundance of S. canicula in the Adriatic Sea (Jukić-Peladić et al. 2001) although there is evidence of constant increasing of trawl fishing pressure. Fishery independent and fishery dependent data from the Tyrrhenian and Ligurian seas were compared by Abella and Serena (2002) to determine population trends. No clear trends were found and apparent discrepancies for this species were considered attributable to a shift in target species and the range of operation of the fishery.

Eastern Central Atlantic:
This species is reported as the most frequent and abundant elasmobranch recorded at 25-300 m depth, and as common down to 400 m depth off Morocco and Sierra Leone (Litvinov 1993).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species is a moderately important commercial species in European waters, particularly around the British Isles. It is primarily taken by bottom trawls, but also fixed bottom nets and pelagic trawls (Compagno in prep.).

Northeast Atlantic
Mostly taken as a bycatch in various demersal fisheries (especially trawl and gill net). In some areas larger specimens may be landed for human consumption or they may be landed as bait for whelk fisheries. They have a high survivorship when discarded from trawl fisheries. Revill et al. (2005) reported a 98% discard survival rate from a Western English channel trawl fishery and Rogriguez-Cabello et al. (2005) found a 90% survival rate for S. canicula discarded by commercial trawlers in the southern Bay of Biscay. Another study reports an almost 100% survival rate of released individuals of this species (Sanchez et al. 2000). S. canicula is frequently recorded misleadingly as "dogfish" in fisheries landings data.

Although S. canicula has been reported to be locally extirpated from the Wadden Sea between the Netherlands and Germany (Wolff 2000a,b), this area is at the edge of the species' distribution. Therefore this localised depletion is not considered to have had a significant effect on the entire global population.

Portuguese official fisheries statistics for landings of Scyliorhinus spp (S. canicula and S. stellaris) in the Algarve (DGPA 1988-2001), show that average landings were 115,079 kg per year during the years 1988, 1989 and 1990, compared to averages of 154,820 kg per year during the years 1999, 2000 and 2001. These values show that there has been an increase of 34.5% in landings by the commercial fishing fleet of this genus in the Algarve during the last decade. However, this increase in landings could mean that there has been a great reduction in discards (DGPA 1988-2001). Only S. canicula were recorded during bottom longline and trammel net surveys off the Algarve (at depths of 200-550 m and 10-90 m, respectively) analysed by Erzini et al. (1998, 2001). No S. stellaris were reported in either of the surveys and therefore the huge majority of Scyliorhinus spp. landings from the Algarve are considered to be S. canicula.

Mediterranean Sea
Captured as bycatch in various demersal fisheries and retained for human consumption in some areas. For example, they are a commercially valuable species in Italy and only individuals <36 cm TL are discarded (Abella and Serena 2005). A semi-industrial fishery for this species operates in Spain, the Adriatic Sea, Sicily and Cyprus. Regularly found in fish markets in countries around the Adriatic Sea, Greece and Malta, where it is sold under the generic name of "Mazzola". Although demersal fishing pressure is intense in many parts of the species range in the Mediterranean, this species has a high post-discard survival rate. Local depletions may have occurred in some areas. Landings data from Malta indicate that catches fell from 1985-1995, but these may not be directly indicative of population trends.

Eastern Central Atlantic
Also taken as bycatch of demersal fisheries operating off the coast of western Africa, although little specific information is available from this area.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
None in place.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: medium; price reliability: reliable: based on ex-vessel price for this species
  • Coppola, S.R., W. Fischer, L. Garibaldi, N. Scialabba and K.E. Carpenter 1994 SPECIESDAB: Global species database for fishery purposes. User's manual. FAO Computerized Information Series (Fisheries). No. 9. Rome, FAO. 103 p. (Ref. 171)
  • Flower, S.S. 1935 Further notes on the duration of life in animals. I. Fishes: as determined by otolith and scale-readings and direct observations on living individuals. Proc. Zool. Soc. London 2:265-304. (Ref. 274)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!