Overview

Brief Summary

The Atlantic sharpnose shark (Rhizoprionodon terraenovae) is common species of requiem shark (family Carcharhinidae) usually inhabiting warm temperate to tropical waters to about 32 feet (10 m) in depth.  They are year round residents in the Gulf of Mexico and north to South Carolina, but are found along the northwest Atlantic from the Yucatan peninsula to the Bay of Fundy and along the coast of Brazil.  In the winter they migrate offshore to deeper waters, and have been recorded to depths of 980 feet (230m).

The Atlantic sharpnose is small in size compared to other requiem sharks, reaching a maximum length of about 3.5 feet (1.1 m).  They have two dorsal fins, the second just above their anal fin.  Adults are various shades of grey with white splotches and stripes of white behind pectoral fins.  Juveniles have striking black tips on their dorsal fins and tail.  They prey on small fish, worms, crustaceans and molluscs.  They are abundant, and one of the most commonly caught coastal shark species, target by shark fisheries and sold for human consumption, and also caught as bycatch in shrimp nets.  While they come into frequent contact with humans and shark bites have been reported, most bites are not serious.  Because they are abundant, mature at an early age, and reasonably fecund, giving birth to 4-7 live pups per year, their conservation status is classified by the IUCN as of Least Concern.

Rhizoprionodon terraenovae is known by a multitude of common names.  Its names Atlantic are sharpnose shark, Newfoundland shark, sharp-nosed shark, and white shark.  Other names include Atlantische scherpsnuithaai (Dutch), bicudo (Portuguese), cação-alecrim (Portuguese), cação-de-bico-doce (Portuguese), cação-fidalgo (Portuguese), cazón (Spanish), cazón chino (Spanish), cazón de ley (Spanish), cazón picudo atlántico (Spanish), chien de mer (French), cucuri (Portuguese), cuur (Wolof), frango (Portuguese), requin à nez pointu (French), requin aiguille gussi (French), squalo di terranuova (Italian), tollito (Spanish), tollo hocicón (Spanish), and tubarao-terranova (Portuguese).

(Cortés 2009; Delius and Morgan 2013; Carpenter 2013; MarineBio Conservation Society 2013)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Dana Campbell

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Reaches at least 103 cm TL (Ref. 244). Abundant in the continental shelves, from the intertidal to deeper waters. Often occurs close to the surf zone off sandy beaches, and also enclosed bays, sounds, and harbors, in estuaries and river mouths. Feeds on small bony fishes, shrimps, crabs, segmented worms and mollusks (gastropod feet). Viviparous, with 1 to 7 young in a litter. Size at birth about 29 to 37 cm. Utilized for human consumption.
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 2 - Carcharhiniformes. FAO Fish. Synop. 125(4/2):251-655. Rome: FAO. (Ref. 244)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

The Atlantic Sharpnose Shark occurs in the western North Atlantic, ranging as far north as New Brunswick, Canada, to the Yucatan Peninsula in the south, including the Gulf of Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

New Brunswick to the Gulf of Mexico
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: New Brunswick, Canada to the Gulf of Mexico. Southwest Atlantic: coasts of Brazil.
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 2 - Carcharhiniformes. FAO Fish. Synop. 125(4/2):251-655. Rome: FAO. (Ref. 244)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Max. size

110 cm TL (male/unsexed; (Ref. 37512)); 110 cm TL (female); max. published weight: 7,250 g (Ref. 40637); max. reported age: 10 years (Ref. 6140)
  • IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA. (Ref. 40637)
  • Bowman, R.E., C.E. Stillwell, W.L. Michaels and M.D. Grosslein 2000 Food of northwest Atlantic fishes and two common species of squid. NOAA Tech. Memo. NMFS-NE 155, 138 p. (Ref. 37512)
  • Parsons, G.R. 1985 Growth and age estimation of the Atlantic sharpnose shark, Rhizoprionodon terraenovae: a comparison of techniques. Copeia 1985(1):80-85. (Ref. 6140)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Small, generally gray, streamlined shark, with long pointed snout. Posterior margin of anal fin straight or slightly concave. Second dorsal fin origin well behind anal fin origin (Ref. 26938).
  • Smith, C.L. 1997 National Audubon Society field guide to tropical marine fishes of the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda. Alfred A. Knopf, Inc., New York. 720 p. (Ref. 26938)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is commonly found off sandy beaches and in estuaries and enclosed bays and sounds, mostly over mud and sand bottoms. There is a seasonal inshore-offshore migration, with individuals moving to deeper offshore waters in winter (Compagno 1984).

The Atlantic Sharpnose Shark is a small, coastal carcharhinid that rarely exceeds 110 cm total length (TL). The life history of this species in the US Gulf of Mexico has been fairly well described. In this area, female seldom exceeds 107 cm TL and males rarely surpass 105 cm TL. Females generally mature between 85-90 cm TL (or 2.8-3.9 years of age) and males mature between 80-85 cm TL (or 2.4-3.5 years of age) (Parsons 1985, Branstetter 1987). Thus, both males and females reach maturity at about 80% of their maximum size. Maximum observed ages in two separate studies were 6+ years and 7+ years for both sexes combined, whereas theoretical longevities derived from von Bertalanffy growth curves predict that this species should reach at least 10 years (Cortés 2000a). Recent tag-recapture information has shown that this species can live to at least nine years (J. Carlson pers. comm.).

The Atlantic Sharpnose Shark is a placental viviparous species that reproduces annually. Gestation period has been reported to last from 10-12 months; litter size is generally 4-6, ranging from 1-7. Offspring are born at 30-35 cm TL or about 30% of maximum adult size. There is a positive correlation between maternal size and litter size and evidence of a trade-off between the number and size of offspring, i.e. there is a negative correlation between litter size and offspring size (Parsons 1983). Mating occurs between mid-May and mid-July and parturition generally takes place mostly in June. The sex ratio at birth is 1:1.

This species uses enclosed bays and sounds as nursery areas. Despite the abundance of this shark, its diet has not been very well described quantitatively. It is dominated by teleost fishes (66%) and crustaceans (32%), but also includes some molluscs (Branstetter 1981, Gelsleichter et al. 1999, Cortés unpubl. data).

Cortés (1995) extensively studied the demography of the Atlantic Sharpnose Shark in the Gulf of Mexico and found that the life history characteristics of this species did not allow it to withstand the levels of fishing mortality it was thought to be subjected to. Recent demographic studies of this species by Cortés (in press) that incorporate uncertainty in estimates of vital rates indicate that the Atlantic Sharpnose Shark has moderate population growth rates (?) (mean=1.056 yr-1; 95% confidence interval = 0.970-1.195 yr-1) and short generation times (?) (mean=4.9 years, 95% CI = 4.0-5.4 years). Elasticity analysis (which examines the proportional sensitivity of ? to a proportional change in a vital rate) also showed that ? is more sensitive to juvenile survival and adult survival than to fertility (which includes survival to age-1). Annual survivorship values used in Cortés (2002) were estimated through five indirect life history methods and ranged from 55-79%.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

coastal species, enters bays and estuaries
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 10 - 280m.
From 10 to 280 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; brackish; marine; depth range 10 - 280 m (Ref. 26938), usually ? - 10 m (Ref. 55195)
  • Smith, C.L. 1997 National Audubon Society field guide to tropical marine fishes of the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda. Alfred A. Knopf, Inc., New York. 720 p. (Ref. 26938)
  • Florida Museum of Natural History 2005 Biological profiles: Atlantic sharpnose shark. Retrieved on 26 August 2005, from www.flmnh.ufl.edu/fish/Gallery/Descript/AtlanticSharpnoseShark/AtlSharpnose.html. Ichthyology at the Florida Museum of Natural History: Education-Biological Profiles. FLMNH, University of Florida. (Ref. 55195)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1196 specimens in 1 taxon.
Water temperature and chemistry ranges based on 375 samples.

Environmental ranges
  Depth range (m): 5 - 280
  Temperature range (°C): 11.619 - 25.874
  Nitrate (umol/L): 0.289 - 14.710
  Salinity (PPS): 32.865 - 36.472
  Oxygen (ml/l): 3.453 - 6.300
  Phosphate (umol/l): 0.078 - 1.177
  Silicate (umol/l): 0.756 - 6.435

Graphical representation

Depth range (m): 5 - 280

Temperature range (°C): 11.619 - 25.874

Nitrate (umol/L): 0.289 - 14.710

Salinity (PPS): 32.865 - 36.472

Oxygen (ml/l): 3.453 - 6.300

Phosphate (umol/l): 0.078 - 1.177

Silicate (umol/l): 0.756 - 6.435
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Loimos Infestation. Parasitic infestations (protozoa, worms, etc.)
  • Hargis, W.J. 1955 Monogenetic trematodes of Gulf of Mexico fishes. Part V. The superfamily Capsaloidea. Trans. Am. Micro. Soc. 74(3):203-225. (Ref. 46261)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Shrimps, molluscs and small fishes
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Distinct pairing with embrace (Ref. 205). Viviparous, placental (Ref. 50449). 1 to 7 young per litter. Larger females carry more young. Size at birth 29-37 cm. Gestation period is 10 to 11 months in the northern Gulf of Mexico. Sex ratio of near term fetuses is 1:1 (Ref. 244).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 10.2 years (wild) Observations: Record longevity of these animals is 10.2 years (Garcia et al. 2008).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhizoprionodon terraenovae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTAATTTTTGGTGCATGGGCAGGTATAGTTGGAACAGCCCTAAGTCTCCTAATTCGAGCCGAACTCGGTCAACCTGGATCTCTCTTAGGAGATGATCAGATTTATAATGTGATCGTAACTGCCCACGCTTTTGTAATAATCTTCTTTATGGTAATGCCAATTATAATTGGTGGTTTCGGAAATTGACTGGTTCCCTTAATAATTGGTGCACCAGATATAGCCTTCCCACGAATAAATAACATGAGCTTTTGACTCCTTCCACCTTCATTCCTTCTTCTCCTAGCTTCTGCTGGAGTAGAAGCTGGAGCAGGTACTGGTTGAACAGTCTATCCCCCATTAGCTAGTAACATAGCTCACGCTGGACCATCTGTTGATCTGGCTATTTTCTCCCTTCATTTAGCCGGTGTTTCATCAATTTTAGCCTCAATTAACTTTATTACAACCATTATCAACATAAAACCACCAGCTATTTCCCAATATCAAACACCTTTATTTGTTTGATCTATTCTTGTAACTACTATTCTCCTTCTCCTTTCACTTCCAGTCCTTGCAGCAGGAATTACAATATTACTTACAGATCGCAACCTTAATACCACATTCTTTGATCCTGCAGGTGGGGGAGACCCAATTCTTTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Rhizoprionodon terraenovae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Specimens with Barcodes: 39
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Cortés, E.

Reviewer/s
Musick, J.A. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
This assessment is based on the information published in the 2005 shark status survey (Fowler et al. 2005).

The Atlantic Sharpnose Shark (Rhizoprionodon terraenovae) is a very abundant, small coastal shark found in warm temperate and tropical waters of the western North Atlantic. It is caught in both commercial and recreational fisheries, and in incidental fisheries, mainly as bycatch in gillnets and shrimp trawl fisheries. A fast maturing, relatively fecund species with moderate population growth rates and short generation times. The juvenile and adult stages seem to affect population growth rates almost equally. The species is assessed as Least Concern because of its abundance and life history characteristics, which make it less susceptible to removals than many other species of sharks.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The Atlantic Sharpnose Shark is an abundant, small coastal shark of warm temperate and tropical waters (Compagno 1984b).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
In the United States, Atlantic Sharpnose Sharks are caught in commercial and recreational fisheries and also as bycatch. Recent commercial landings of this species indicate that it accounted for over one-third of all landings of small coastal sharks in the south-eastern United States during 1996-1999. In 1998 and 1999, over 90% of small coastal sharks were landed in Florida's east coast, the majority of which were caught with drift gillnet gear. Commercial landings of Atlantic Sharpnose Sharks averaged 61,000 individuals from 1995-1999 (Cortés 2000b).

Recreational catch estimates from several surveys indicate that about 72,000 Atlantic Sharpnose Sharks were caught annually from 1981-1998, ranging from a minimum of about 18,000 sharks in 1985 to a peak of about 137,000 sharks caught in 1991 (Cortés 2000b). Additionally, bycatch estimates from the shrimp trawl fishery operating in the Gulf of Mexico indicate that about 1.75 million individuals were caught annually from 1972-1999 (Cortés unpubl.).

The Atlantic Sharpnose Shark is also heavily exploited in Mexico. A monitoring programme conducted in the Gulf of Mexico between November 1993 and December 1994 showed that it is the most important species in the artisanal fisheries, accounting for 46% of the landings numerically, especially in Campeche where 46% of the total is landed (Castillo et al. 1998). By month, the highest landings corresponded to May and October. This species is caught mostly with gillnets. Elsewhere this species has been documented as bycatch in Canada.

Nursery areas for this species are located inshore and adults frequent inshore waters, making this species vulnerable to exploitation and human-induced habitat degradation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In the United States, the Atlantic Sharpnose Shark is classified as a small coastal species in the Federal Management Plan (FMP) for Sharks of the Atlantic Ocean, Gulf of Mexico and Caribbean, together with the Blacknose Shark (Carcarhinus acronotus), the Finetooth Shark (C. isodon), the Bonnethead Sharl (Sphyrna tiburo), the Smalltail Shark (C. porosus), the Atlantic Angel Shark (Squatina dumeril) and the Caribbean Sharpnose Shark (Rhizoprionodon porosus) (NMFS 1993). The small coastal shark complex is not currently considered to be overfished, but there are fishing regulations in effect, which include an annual commercial quota of 1,760 t dressed weight, and a recreational daily bag limit of two sharks per vessel per trip, with an additional allowance of two Atlantic Sharpnose Sharks per person per trip. A more recent FMP (NMFS 1999) called for more stringent measures, including a reduction of the annual commercial quota for small coastal sharks to 359 t and making the Atlantic angelshark, Caribbean sharpnose and smalltail sharks prohibited species.

This is a very abundant species, with early age at maturity, short lifespan and generation time, and moderately high litter size and population growth rates, capable of withstanding a higher level of removals than many other species of sharks. It is thus considered to be of low risk of extinction because of its life history and population characteristics.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; gamefish: yes
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
  • Coppola, S.R., W. Fischer, L. Garibaldi, N. Scialabba and K.E. Carpenter 1994 SPECIESDAB: Global species database for fishery purposes. User's manual. FAO Computerized Information Series (Fisheries). No. 9. Rome, FAO. 103 p. (Ref. 171)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Atlantic sharpnose shark

The Atlantic sharpnose shark, Rhizoprionodon terraenovae, is a requiem shark in the family Carcharhinidae, found in the subtropical waters of the northwestern Atlantic Ocean, between latitudes 43° N and 18° N.

Description[edit]

Atlantic sharpnose shark

The Atlantic sharpnose shark is a small shark in comparison to others. The Atlantic sharpnose shark's maximum species length is known to be about 110–120 cm (3.6–3.9 ft). Although its average adult size tends to be about 91.4–99 cm (3.00–3.25 ft). There has been reports of these sharks living up to 10–12 years in the wild. A distinctive feature of the Atlantic sharpnose shark is that it has two dorsal fins; the first is located above the pectoral rear tips the second is smaller and is located above the middle of the anal fin. Another distinctive feature is that juveniles have black edges on the dorsal and caudal fins.[1]


Habitat[edit]

Atlantic sharpnose sharks can be found as far north as New Brunswick, Canada, to as far south as the Southern Gulf of Mexico. Reports of specimens from Brazil, are likely being confused with the Brazilian Sharpnose Shark. Atlantic sharpnose sharks prefer warmer shallow coastal waters to live in. As they are often found in waters of less than 10.1 meters (33 feet)deep. Although there have been reports of Atlantic Sharpnose being found at up to 280 meters (920 feet) deep.[1][2][3]

Feeding Habits[edit]

The diet of the Atlantic sharpnose mostly consists of bony fish, worms, shrimp, crabs, and mollusks. Of the bony fish that are commonly consumed are menhaden, eels, silversides, wrasses, jacks, toadfish, and filefish.[1]

Maturation[edit]

Atlantic sharpnose sharks are born ranging from a length of 29–37 cm (11–15 in). For the first three months after birth, Atlantic sharpnose sharks will grow an average 5 centimeters (2.0 in) per month. Then, in the winter and spring months, the average growth rate decreases to 0.9 centimeters (0.35 in) per month until the shark reaches a length of 60 to 65 centimeters (24 to 26 in), in which the shark's growth rate will increases linearly about 1.3 centimeters (0.51 in) per month for approximately a year. Male Atlantic sharpnose sharks mature at the age of 2–3 years old and will have a length of 80–85 cm (31–33 in). While females seem to mature at the age of 2.5–3.5 years old, at a length of about 84–89 cm (33–35 in).[1]

Reproduction[edit]

Female Atlantic sharpnose sharks are viviparous, which means they have live birth. Atlantic Sharpnose sharks tend to have a litter of 4 to 6 pups, but litter size may range from 1 to 7 pups, after a gestation period of 10–11 months. The pups are usually born at between 29–37 cm (11–15 in) in total length. Females will often be found in the marine estuaries during the late spring months, but they breed mostly throughout the year. They tend to mature around 2–3 years of age.[1][2][3]

Captivity[edit]

Generally they are better suited for public aquariums, or very experienced private shark aquarists, which are capable of caring for active requiem sharks. These sharks are highly active swimmers and require lots of space. Also these sharks tend to do best in small schools of at least 3–5 sharks. Tanks or ponds which are round or oval shaped in design are best suited for these sharks. Atlantic Sharpnose sharks have been reported to live at least 4 years in captivity.

References[edit]

  1. ^ a b c d e "Atlantic Sharpnose Shark". Florida Museum of Natural History. Retrieved 5 August 2013. 
  2. ^ a b "Rhizoprionodon terraenovae". International Union for Conservation of Nature and Natural Resources. 13 August 2013. Retrieved 18 August 2013. 
  3. ^ a b "Rhizoprionodon terraenovae (Richardson, 1836) Atlantic sharpnose shark". FishBase. Retrieved 18 August 2013. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!