Overview

Comprehensive Description

Biology

Reaches at least 103 cm TL (Ref. 244). Abundant in the continental shelves, from the intertidal to deeper waters. Often occurs close to the surf zone off sandy beaches, and also enclosed bays, sounds, and harbors, in estuaries and river mouths. Feeds on small bony fishes, shrimps, crabs, segmented worms and mollusks (gastropod feet). Viviparous, with 1 to 7 young in a litter. Size at birth about 29 to 37 cm. Utilized for human consumption.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: New Brunswick, Canada to the Gulf of Mexico. Southwest Atlantic: coasts of Brazil.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Atlantic Sharpnose Shark occurs in the western North Atlantic, ranging as far north as New Brunswick, Canada, to the Yucatan Peninsula in the south, including the Gulf of Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

New Brunswick to the Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Maine, Gulf of Mexico, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Max. size

110 cm NG (male/unsexed; (Ref. 37512)); 110 cm TL (female); max. published weight: 7,250 g (Ref. 40637); max. reported age: 10 years (Ref. 6140)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Small, generally gray, streamlined shark, with long pointed snout. Posterior margin of anal fin straight or slightly concave. Second dorsal fin origin well behind anal fin origin (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth: 10 - 280m.
From 10 to 280 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; brackish; marine; depth range 10 - 280 m (Ref. 26938), usually ? - 10 m (Ref. 55195)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is commonly found off sandy beaches and in estuaries and enclosed bays and sounds, mostly over mud and sand bottoms. There is a seasonal inshore-offshore migration, with individuals moving to deeper offshore waters in winter (Compagno 1984).

The Atlantic Sharpnose Shark is a small, coastal carcharhinid that rarely exceeds 110 cm total length (TL). The life history of this species in the US Gulf of Mexico has been fairly well described. In this area, female seldom exceeds 107 cm TL and males rarely surpass 105 cm TL. Females generally mature between 85?90 cm TL (or 2.8?3.9 years of age) and males mature between 80?85 cm TL (or 2.4?3.5 years of age) (Parsons 1985, Branstetter 1987). Thus, both males and females reach maturity at about 80% of their maximum size. Maximum observed ages in two separate studies were 6+ years and 7+ years for both sexes combined, whereas theoretical longevities derived from von Bertalanffy growth curves predict that this species should reach at least 10 years (Cortés 2000a). Recent tag-recapture information has shown that this species can live to at least nine years (J. Carlson pers. comm.).

The Atlantic Sharpnose Shark is a placental viviparous species that reproduces annually. Gestation period has been reported to last from 10?12 months; litter size is generally 4?6, ranging from 1?7. Offspring are born at 30?35 cm TL or about 30% of maximum adult size. There is a positive correlation between maternal size and litter size and evidence of a trade-off between the number and size of offspring, i.e. there is a negative correlation between litter size and offspring size (Parsons 1983). Mating occurs between mid-May and mid-July and parturition generally takes place mostly in June. The sex ratio at birth is 1:1.

This species uses enclosed bays and sounds as nursery areas. Despite the abundance of this shark, its diet has not been very well described quantitatively. It is dominated by teleost fishes (66%) and crustaceans (32%), but also includes some molluscs (Branstetter 1981, Gelsleichter et al. 1999, Cortés unpubl. data).

Cortés (1995) extensively studied the demography of the Atlantic Sharpnose Shark in the Gulf of Mexico and found that the life history characteristics of this species did not allow it to withstand the levels of fishing mortality it was thought to be subjected to. Recent demographic studies of this species by Cortés (in press) that incorporate uncertainty in estimates of vital rates indicate that the Atlantic Sharpnose Shark has moderate population growth rates (?) (mean=1.056 yr-1; 95% confidence interval = 0.970?1.195 yr-1) and short generation times (?) (mean=4.9 years, 95% CI = 4.0?5.4 years). Elasticity analysis (which examines the proportional sensitivity of ? to a proportional change in a vital rate) also showed that ? is more sensitive to juvenile survival and adult survival than to fertility (which includes survival to age-1). Annual survivorship values used in Cortés (2002) were estimated through five indirect life history methods and ranged from 55?79%.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

coastal species, enters bays and estuaries
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1196 specimens in 1 taxon.
Water temperature and chemistry ranges based on 375 samples.

Environmental ranges
  Depth range (m): 5 - 280
  Temperature range (°C): 11.619 - 25.874
  Nitrate (umol/L): 0.289 - 14.710
  Salinity (PPS): 32.865 - 36.472
  Oxygen (ml/l): 3.453 - 6.300
  Phosphate (umol/l): 0.078 - 1.177
  Silicate (umol/l): 0.756 - 6.435

Graphical representation

Depth range (m): 5 - 280

Temperature range (°C): 11.619 - 25.874

Nitrate (umol/L): 0.289 - 14.710

Salinity (PPS): 32.865 - 36.472

Oxygen (ml/l): 3.453 - 6.300

Phosphate (umol/l): 0.078 - 1.177

Silicate (umol/l): 0.756 - 6.435
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Loimos Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct pairing with embrace (Ref. 205). Viviparous, placental (Ref. 50449). 1 to 7 young per litter. Larger females carry more young. Size at birth 29-37 cm. Gestation period is 10 to 11 months in the northern Gulf of Mexico. Sex ratio of near term fetuses is 1:1 (Ref. 244).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 10.2 years (wild) Observations: Record longevity of these animals is 10.2 years (Garcia et al. 2008).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhizoprionodon terraenovae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACTTAATTTTTGGTGCATGGGCAGGTATAGTTGGAACAGCCCTAAGTCTCCTAATTCGAGCCGAACTCGGTCAACCTGGATCTCTCTTAGGAGATGATCAGATTTATAATGTGATCGTAACTGCCCACGCTTTTGTAATAATCTTCTTTATGGTAATGCCAATTATAATTGGTGGTTTCGGAAATTGACTGGTTCCCTTAATAATTGGTGCACCAGATATAGCCTTCCCACGAATAAATAACATGAGCTTTTGACTCCTTCCACCTTCATTCCTTCTTCTCCTAGCTTCTGCTGGAGTAGAAGCTGGAGCAGGTACTGGTTGAACAGTCTATCCCCCATTAGCTAGTAACATAGCTCACGCTGGACCATCTGTTGATCTGGCTATTTTCTCCCTTCATTTAGCCGGTGTTTCATCAATTTTAGCCTCAATTAACTTTATTACAACCATTATCAACATAAAACCACCAGCTATTTCCCAATATCAAACACCTTTATTTGTTTGATCTATTCTTGTAACTACTATTCTCCTTCTCCTTTCACTTCCAGTCCTTGCAGCAGGAATTACAATATTACTTACAGATCGCAACCTTAATACCACATTCTTTGATCCTGCAGGTGGGGGAGACCCAATTCTTTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Rhizoprionodon terraenovae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Specimens with Barcodes: 39
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Cortés, E.

Reviewer/s
Musick, J.A. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
This assessment is based on the information published in the 2005 shark status survey (Fowler et al. 2005).

The Atlantic Sharpnose Shark (Rhizoprionodon terraenovae) is a very abundant, small coastal shark found in warm temperate and tropical waters of the western North Atlantic. It is caught in both commercial and recreational fisheries, and in incidental fisheries, mainly as bycatch in gillnets and shrimp trawl fisheries. A fast maturing, relatively fecund species with moderate population growth rates and short generation times. The juvenile and adult stages seem to affect population growth rates almost equally. The species is assessed as Least Concern because of its abundance and life history characteristics, which make it less susceptible to removals than many other species of sharks.

History
  • 2000
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The Atlantic Sharpnose Shark is an abundant, small coastal shark of warm temperate and tropical waters (Compagno 1984b).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
In the United States, Atlantic Sharpnose Sharks are caught in commercial and recreational fisheries and also as bycatch. Recent commercial landings of this species indicate that it accounted for over one-third of all landings of small coastal sharks in the south-eastern United States during 1996?1999. In 1998 and 1999, over 90% of small coastal sharks were landed in Florida?s east coast, the majority of which were caught with drift gillnet gear. Commercial landings of Atlantic Sharpnose Sharks averaged 61,000 individuals from 1995?1999 (Cortés 2000b).

Recreational catch estimates from several surveys indicate that about 72,000 Atlantic Sharpnose Sharks were caught annually from 1981?1998, ranging from a minimum of about 18,000 sharks in 1985 to a peak of about 137,000 sharks caught in 1991 (Cortés 2000b). Additionally, bycatch estimates from the shrimp trawl fishery operating in the Gulf of Mexico indicate that about 1.75 million individuals were caught annually from 1972?1999 (Cortés unpubl.).

The Atlantic Sharpnose Shark is also heavily exploited in Mexico. A monitoring programme conducted in the Gulf of Mexico between November 1993 and December 1994 showed that it is the most important species in the artisanal fisheries, accounting for 46% of the landings numerically, especially in Campeche where 46% of the total is landed (Castillo et al. 1998). By month, the highest landings corresponded to May and October. This species is caught mostly with gillnets. Elsewhere this species has been documented as bycatch in Canada.

Nursery areas for this species are located inshore and adults frequent inshore waters, making this species vulnerable to exploitation and human-induced habitat degradation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In the United States, the Atlantic Sharpnose Shark is classified as a small coastal species in the Federal Management Plan (FMP) for Sharks of the Atlantic Ocean, Gulf of Mexico and Caribbean, together with the Blacknose Shark (Carcarhinus acronotus), the Finetooth Shark (C. isodon), the Bonnethead Sharl (Sphyrna tiburo), the Smalltail Shark (C. porosus), the Atlantic Angel Shark (Squatina dumeril) and the Caribbean Sharpnose Shark (Rhizoprionodon porosus) (NMFS 1993). The small coastal shark complex is not currently considered to be overfished, but there are fishing regulations in effect, which include an annual commercial quota of 1,760 t dressed weight, and a recreational daily bag limit of two sharks per vessel per trip, with an additional allowance of two Atlantic Sharpnose Sharks per person per trip. A more recent FMP (NMFS 1999) called for more stringent measures, including a reduction of the annual commercial quota for small coastal sharks to 359 t and making the Atlantic angelshark, Caribbean sharpnose and smalltail sharks prohibited species.

This is a very abundant species, with early age at maturity, short lifespan and generation time, and moderately high litter size and population growth rates, capable of withstanding a higher level of removals than many other species of sharks. It is thus considered to be of low risk of extinction because of its life history and population characteristics.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Atlantic sharpnose shark

Atlantic sharpnose shark

The Atlantic sharpnose shark, Rhizoprionodon terraenovae, is a requiem shark of the family Carcharhinidae, found in the subtropical waters of the northwestern Atlantic Ocean between latitudes 43° N and 25° S,

Contents

Habitat

Atlantic Sharpnose sharks are found in the northwestern Atlantic Ocean & Gulf of Mexico, and quite often found in the Caribbean sea. Atlantic Sharpnose sharks prefer warmer shallow waters across coasts to live in.

Size

The Atlantic Sharpnose Shark's maximum species length is 3 ft in total length at roughly 2-4 years of age. Atlantic Sharpnose sharks may live to 6-10 years of age. They tend to mature around 2-3 years in age.

Reproduction

Females give live-birth to a litter of 3-8 pups after a gestation period of 10-11 months. The pups are usually born at between (6-7 inches) in total length. Females will often be found in the marine estuaries during the late spring months, but they breed mostly throughout the year. They tend to mature around 2-3 years of age.

Captivity

These sharks are highly active swimmers and space is needed. Aquariums that are round or oval shaped are best suited for shark. These sharks may live up to 12 years in aquariums. Due to small size of active sharks they are very well suited in rather pond/tanks than your typical aquarium.

References

iucnredlist.org

Atlantic Sharpnose Shark

www.marinebiodiversity.ca

Florida Museum of Natural History - Ichthyology Dept.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!