Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults inhabit coral-rich and surge areas of clear lagoon and seaward reefs (Ref. 1602). Commonly associated with Pocillopora or Acropora corals (Ref. 1602). Feed on filamentous algae, small benthic invertebrates, and occasionally small fishes (Ref. 1602). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205). Minimum depth range taken from Ref. 7247.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa to the Line and Tuamoto islands, north to Japan, south to Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: South Africa, East Africa, Seychelles, Madagascar and Mascarenes east to Wake Atoll, Marquesas Islands and Tuamotu Archipelago, north to southern Japan, south to Western Australia, Lord Howe Island, New Caledonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 16 - 18; Analspines: 2; Analsoft rays: 14 - 16
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 110 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

11.0 cm TL (male/unsexed; (Ref. 4391))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Inhabits coral rich and surgy areas of clear lagoon and seaward reefs (Ref. 1602). Commonly associated with @Pocillopora@ or @Acropora@ corals (Ref. 1602). Feeds on filamentous algae, small benthic invertebrates, and occasionally small fishes (Ref. 1602).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Easily identified by the white tail (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 1 - 15 m (Ref. 30874)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 125 specimens in 1 taxon.
Water temperature and chemistry ranges based on 97 samples.

Environmental ranges
  Depth range (m): 0.7625 - 50
  Temperature range (°C): 25.709 - 29.336
  Nitrate (umol/L): 0.016 - 2.714
  Salinity (PPS): 32.200 - 36.142
  Oxygen (ml/l): 4.427 - 4.802
  Phosphate (umol/l): 0.083 - 0.507
  Silicate (umol/l): 0.897 - 4.892

Graphical representation

Depth range (m): 0.7625 - 50

Temperature range (°C): 25.709 - 29.336

Nitrate (umol/L): 0.016 - 2.714

Salinity (PPS): 32.200 - 36.142

Oxygen (ml/l): 4.427 - 4.802

Phosphate (umol/l): 0.083 - 0.507

Silicate (umol/l): 0.897 - 4.892
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 15m.
From 1 to 15 meters.

Habitat: reef-associated. Narrowbar damsel.  (Lienard, 1839) Attains 11 cm. Body mainly tan; scales with narrow brown outlines; conspicuous black bar across posterior part of body; caudal peduncle and caudal fin white; pectoral fins yellow. Similar to P. johnstonianus but with narrower black bar at rear of body and white caudal fin instead of yellow. Inhabits clear water coastal reefs, lagoons to outer reefs in large coral heads at depths of between 1 - 12 metres. A distinct species showing very little variation with growth or between different areas. Tropical Indo-West Pacific, south to Sodwana Bay in South Africa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Is an opportunistic species which will take smaller fish and doubtless swimming invertebrates which venture near it (Ref. 275). Inhabits coral-rich and surge areas of clear lagoon and seaward reefs (Ref. 1602). Commonly associated with Pocillopora or Acropora corals (Ref. 1602). Feeds on filamentous algae, small benthic invertebrates, and occasionally small fishes (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Plectroglyphidodon dickii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Plectroglyphidodon dickii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTTGGAACAGCTTTAAGCCTCCTTATTCGGGCAGAACTTAGTCAACCAGGCGCTCTCCTCGGAGACGACCAAATCTATAATGTTATTGTCACGGCACACGCCTTTGTAATAATTTTCTTTATAGTAATACCCATTATGATCGGAGGGTTCGGAAACTGACTCATCCCTCTTATGATCGGGGCCCCGGACATGGCCTTCCCTCGCATGAATAACATAAGCTTCTGACTCCTCCCTCCCTCATTCCTTCTCCTACTTGCTTCTTCCGGAGTTGAAGCAGGGGCTGGAACAGGATGGACTGTATACCCTCCACTATCCGGCAATCTCGCTCACGCAGGGGCCTCCGTTGATTTAACCATTTTCTCCCTCCACCTAGCAGGCGTTTCCTCTATTCTCGGGGCAATCAACTTTATCACAACTATTATTAACATAAAACCACCTGCTATTTCCCAGTACCAGACCCCTCTCTTTGTGTGAGCCGTGCTAATCACTGCTGTCCTACTCCTCCTATCTCTCCCAGTACTAGCCGCCGGAATTACAATGCTTCTAACCGATCGAAACCTAAACACCACCTTCTTTGACCCCGCAGGCGGAGGGGATCCTATTTTATACCAACATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!