Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults occur among rubble or consolidated reef rock of exposed intertidal reef flats and sandy beaches, subject to mild surge. Also near freshwater run-offs (Ref. 48636). They occur in small groups. Feed mainly on benthic algae. Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
  • Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa to the Line and Pitcairn islands, north to Japan, south to Australia.
  • Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: South Africa, East Africa, Seychelles, Madagascar and Mascarenes east to Wake Atoll, Line Islands and Gambier Islands, north to Izu Islands, south to Western Australia, Lord Howe Island, New Caledonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 12 - 13; Analspines: 2; Analsoft rays: 11 - 13
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

11.5 cm TL (male/unsexed; (Ref. 90102))
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 100 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: Overall bluish grey, body scales streaks bluish, head lines/spots blue (Ref. 90102). Juveniles are a brilliant blue, but lighter in coloration and not as spectacular as C. cyaneus, becoming dull bluish grey with growth (Ref. 1602).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Occurs among rubble or consolidated reef rock of exposed intertidal reef flats and sandy beaches, subject to mild surge. Occurs in small groups. Feeds mainly on benthic algae.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 0 - 3 m (Ref. 30874)
  • Allen, G.R. and R.C. Steene 1988 Fishes of Christmas Island Indian Ocean. Christmas Island Natural History Association, Christmas Island, Indian Ocean, 6798, Australia. 197 p. (Ref. 30874)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 126 specimens in 1 taxon.
Water temperature and chemistry ranges based on 116 samples.

Environmental ranges
  Depth range (m): 0.08 - 100
  Temperature range (°C): 25.282 - 29.336
  Nitrate (umol/L): 0.052 - 1.204
  Salinity (PPS): 34.080 - 36.148
  Oxygen (ml/l): 4.454 - 4.757
  Phosphate (umol/l): 0.085 - 0.351
  Silicate (umol/l): 1.019 - 6.449

Graphical representation

Depth range (m): 0.08 - 100

Temperature range (°C): 25.282 - 29.336

Nitrate (umol/L): 0.052 - 1.204

Salinity (PPS): 34.080 - 36.148

Oxygen (ml/l): 4.454 - 4.757

Phosphate (umol/l): 0.085 - 0.351

Silicate (umol/l): 1.019 - 6.449
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 3m.
Recorded at 3 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154); among rubble or consolidated reef rock of exposed intertidal reef flats and sandy beaches, subject to mild surge. Found in small groups. Feeds mainly on benthic algae.
  • Sano, M., M. Shimizu and Y. Nose 1984 Food habits of teleostean reef fishes in Okinawa Island, southern Japan. University of Tokyo Bulletin, no. 25. v,128p. University of Tokyo Press, Tokyo, Japan. 128 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chrysiptera glauca

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATTTAGTATTCGGTGCTTGAGCTGGAATAGTAGGCACAGCCTTAAGCCTTCTCATTCGAGCAGAACTAAGCCAACCAGGCGCACTCCTAGGAGACGACCAGATTTATAATGTTATCGTAACTGCACATGCCTTTGTAATAATTTTCTTTATGGTAATACCAATTCTTATTGGCGGGTTTGGAAACTGACTAGTCCCCCTAATGCTCGGAGCCCCTGATATGGCATTCCCCCGAATGAATAACATAAGCTTCTGACTTCTGCCCCCATCATTCCTTCTCTTGCTTGCCTCTTCTGGGGTCGAAGCAGGGGCTGGGACAGGCTGAACTGTCTACCCCCCACTATCTGGGAACCTCGCCCATGCCGGGGCATCAGTAGACCTAACTATTTTCTCCCTCCACCTGGCAGGCATTTCATCAATTCTGGGGGCAATCAACTTCATCACCACTATTATTAACATAAAACCCCCTGCCATCTCACAATACCAGACCCCTCTGTTTGTGTGAGCTGTCCTCATCACCGCCGTCCTTCTTCTCCTGTCACTCCCAGTCTTAGCTGCTGGTATTACCATGCTCTTAACTGACCGAAATCTAAATACCACTTTCTTCGACCCAGCGGGAGGAGGAGACCCCATTCTCTACCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chrysiptera glauca

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!