Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults are found amongst rubble and coral of clear sheltered lagoons and subtidal reef flats (Ref. 9710, 48636). They occur in groups of a male and several females or juveniles (Ref. 1602). Feed on algae, pelagic tunicates and copepods. Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific: eastern edge of the Indian Ocean and Western Australia to New Guinea, New Britain, Solomon Islands, Marianas and Caroline Islands, Indonesia, Philippines, Taiwan and Ryukyu Islands. Also known from Vanuatu and New Caledonia; Palau and Yap in Micronesia (Ref. 1602); Samoa (Ref. 4537).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 12 - 13; Analspines: 2; Analsoft rays: 13 - 14
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 80 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

8.5 cm TL (male/unsexed; (Ref. 48636))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Recognized by the brilliant light-blue color (Ref. 48636). This species exhibits a marked sexual dichromatism: juveniles and females usually have a small black spot at the rear base of the dorsal fin and (at least in Micronesia) lack yellow; males have a bright yellow snout and tail and sometimes, latter all orange in some regions; also lack the black spot.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Chrysiptera cyanea
Catalog Number: USNM 61682
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): R. McGregor
Locality: Ticao, Philippine Is., Philippines, Pacific
  • Paratype: Jordan, D. S. & Richardson, R. E. 1908. Bulletin of the United States Bureau of Fisheries. 27 (for 1907): 264.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 0 - 10 m (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 72 specimens in 1 taxon.
Water temperature and chemistry ranges based on 59 samples.

Environmental ranges
  Depth range (m): 0.15 - 29
  Temperature range (°C): 25.712 - 29.325
  Nitrate (umol/L): 0.043 - 2.007
  Salinity (PPS): 33.821 - 35.265
  Oxygen (ml/l): 4.442 - 4.764
  Phosphate (umol/l): 0.103 - 0.213
  Silicate (umol/l): 0.869 - 7.448

Graphical representation

Depth range (m): 0.15 - 29

Temperature range (°C): 25.712 - 29.325

Nitrate (umol/L): 0.043 - 2.007

Salinity (PPS): 33.821 - 35.265

Oxygen (ml/l): 4.442 - 4.764

Phosphate (umol/l): 0.103 - 0.213

Silicate (umol/l): 0.869 - 7.448
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 10m.
Recorded at 10 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found amongst rubble and coral of clear sheltered lagoons and reef flats (Ref. 9710). Occurs in groups of a male and several females or juveniles (Ref. 1602). The habitat consists of lagoons and protected inshore reefs in knee-depth shallows down to about 10 m (Ref. 54301). Feeds on plants and invertebrates (Ref. 6110).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Livoneca Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chrysiptera cyanea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCTTGAGCTGGAATGGTAGGCACAGCCCTGAGCCTTCTCATTCGAGCAGAACTAAGCCAACCGGGCGCACTCCTAGGAGACGACCAGATTTATAACGTCATCGTTACCGCACACGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTCTAATTGGAGGCTTTGGGAACTGATTAGTTCCTCTGATGTTAGGAGCCCCCGACATAGCATTCCCTCGAATGAACAACATGAGCTTCTGGCTGCTACCCCCATCGTTCCTCCTCCTCCTCGCCTCTTCAGGAGTTGAGGCCGGAGCTGGCACAGGCTGAACTGTTTACCCCCCTCTATCCGGCAACCTTGCCCATGCAGGCGCATCAGTTGACCTCACCATTTTCTCCCTACACTTGGCAGGTGTTTCATCTATTCTGGGAGCAATTAATTTTATTACTACCATTATCAACATGAAACCCCCAGCCATCACACAATACCAAACCCCGTTGTTTGTCTGGGCAGTCTTAATTACCGCTGTCCTTCTACTCCTTTCCCTACCAGTTTTAGCCGCTGGCATCACTATGCTCTTAACGGACCGAAACCTTAACACAACTTTCTTCGACCCAGCAGGGGGAGGGGACCCAATCCTTTACCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chrysiptera cyanea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 29
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Chrysiptera cyanea

Chrysiptera cyanea is a species of damselfish native to the Indian and western Pacific Oceans.[1] Common names include blue damselfish, blue demoiselle, blue devil, cornflower sergeant-major, Hedley's damselfish, red tail Australian damsel, sapphire devil, and sky-blue damsel.[2]

Description[edit]

This fish reaches 8.5 centimeters in length. It is bright blue in color; the male has a yellow snout and tail, and the female and juvenile usually lack yellow but have a black spot at the base of the back edge of the dorsal fin.[1]

Behavior[edit]

The fish inhabits reefs and lagoons. Its diet includes algae, tunicates, and copepods. Male and female pair up for breeding, and the male guards and tends the eggs.[1]

References[edit]

  1. ^ a b c Froese, R. and D. Pauly, Eds. Chrysiptera cyanea. FishBase. 2011.
  2. ^ Froese, R. and D. Pauly, Eds. Common names of Chrysiptera cyanea. FishBase. 2011.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!